BEAST XML Reference

XML

BEAST XML Elements

The following is a list of valid elements in a beast file.

`<adaptableSizeFastMatrixParameter>` element

Returns a blockUpperTriangularMatrixParameter which is a compoundParameter which forces the last element to be of full length, the second to last element to be of full length-1, etc.

The element takes following attributes:

columns (optional) is of type Integer
rows (optional) is of type Integer
maxRowSize (optional) is of type Integer
maxColumnSize (optional) is of type Integer
startingValue (optional) is of type Double
lowerTriangle (optional) is of type Boolean

Example:

<adaptableSizeFastMatrixParameter columns="1" rows="1" maxRowSize="1" maxColumnSize="1" startingValue="1.0" lowerTriangle="true"/>

`<adaptableVarianceMultivariateNormalOperator>` element

This element returns an adaptable variance multivariate normal operator on a given parameter.

The element takes following attributes:

scaleFactor is of type Double
weight is of type Double
beta is of type Double
coefficient is of type Double
initial is of type Integer
burnin (optional) is of type Integer
updateEvery (optional) is of type Integer
autoOptimize (optional) is of type Boolean
formXtXInverse (optional) is of type Boolean
skipRankCheck (optional) is of type Boolean

The element has the following contents:

Parameter elements (zero or more)
Transform$ParsedTransform elements (zero or more)

Example:

<adaptableVarianceMultivariateNormalOperator scaleFactor="1.0" weight="1.0" beta="1.0" coefficient="1.0" initial="1" burnin="1" updateEvery="1" autoOptimize="true" formXtXInverse="true" skipRankCheck="true">
  <mvPolyaLikelihood>
    <data>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </data>
    <alpha>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix4">
    </alpha>
  </mvPolyaLikelihood>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform8">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform10">
    </inner>
  </composedTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform10">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform8">
    </inner>
  </composedTransform>
  <inverseTransform>
    <inverseTransform idref="inverseTransform1">
  </inverseTransform>
</adaptableVarianceMultivariateNormalOperator>

`<addremoveARGEvent>` element

An operator that slides a subarg.

The element takes following attributes:

weight is of type Integer
size is of type Double
gaussian is of type Boolean
swapRates (optional) is of type Boolean
swapTraits (optional) is of type Boolean
autoOptimize (optional) is of type Boolean

The element has the following contents:

ARGModel element (exactly one)

Example:

<addremoveARGEvent weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel partitionType="reassortment">
    <starTreeModel idref="starTreeModel5">
    <rootHeight>
      <complementParameter idref="complementParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <sumParameter idref="sumParameter6">
    </nodeHeights>
  </argTreeModel>
</addremoveARGEvent>

`<aicmAnalysis>` element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

fileName is of type String

“The traceName of a BEAST log file (can not include trees, which should be logged separately”
burnIn (optional) is of type Integer
bootstrapLength (optional) is of type Integer

The element has the following contents:

Element named <likelihoodColumn>

Containing:
- name is of type String
  
  “The column name”

Example:

<aicmAnalysis fileName="foo" burnIn="1" bootstrapLength="1">
  <likelihoodColumn name="foo"/>
</aicmAnalysis>

`<alignment>` element

This element represents an alignment of molecular sequences.

The element has the following contents:

One of:
- dataType is of type String
  
  “The data type”
- DataType element (exactly one)
Sequence elements (one or more)

Example:

<!-- An alignment of three short DNA sequences -->
<alignment missing="-?" dataType="nucleotide">
  <sequence>
    <taxon idref="taxon1"/>
    ACGACTAGCATCGAGCTTCG--GATAGCAGGC
  </sequence>
  <sequence>
    <taxon idref="taxon2"/>
    ACGACTAGCATCGAGCTTCGG-GATAGCATGC
  </sequence>
  <sequence>
    <taxon idref="taxon3"/>
    ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
  </sequence>
</alignment>

`<alloppNetworkPriorModel>` element

Model for speciation, extinction, hybridization in allopolyploid network.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <eventRate>

Containing:
- Parameter element (exactly one)
Element named <populationScalingFactor>

Containing:
- Parameter element (exactly one)
Element named <tipPopulationDistribution>

Containing:
- ParametricDistributionModel element (exactly one)
Element named <rootPopulationDistribution>

Containing:
- ParametricDistributionModel element (exactly one)
Element named <hybridPopulationDistribution>

Containing:
- ParametricDistributionModel element (exactly one)

Example:

<alloppNetworkPriorModel units="days">
  <eventRate>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter9">
  </eventRate>
  <populationScalingFactor>
    <immutableParameter idref="immutableParameter9">
  </populationScalingFactor>
  <tipPopulationDistribution>
    <normalDistributionModel idref="normalDistributionModel1">
  </tipPopulationDistribution>
  <rootPopulationDistribution>
    <negativeBinomialDistributionModel idref="negativeBinomialDistributionModel1">
  </rootPopulationDistribution>
  <hybridPopulationDistribution>
    <onePGammaDistributionModel idref="onePGammaDistributionModel4">
  </hybridPopulationDistribution>
</alloppNetworkPriorModel>

`<alloppNumHybsStatistic>` element

Statistic for number of hybridizations in allopolyploid network

The element has the following contents:

Element named <apspNetwork>

Containing:
- AlloppSpeciesNetworkModel element (exactly one)

Example:

<alloppNumHybsStatistic>
  <apspNetwork>
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork6">
  </apspNetwork>
</alloppNumHybsStatistic>

`<alloppspecies>` element

Binds taxa to gene trees with information about possibly allopolyploid species.

The element takes following attributes:

minGeneNodeHeight is of type Double

The element has the following contents:

AlloppSpeciesBindings$ApSpInfo elements ( or more)
Element named <geneTrees>

Containing:
- TreeModel elements (zero or more)
- Element named <gtree>
  
  Containing:
  - popfactor is of type Double
  - TreeModel element (exactly one)

Example:

<alloppspecies minGeneNodeHeight="1.0">
  <apsp ploidylevel="1.0">
    <individual idref="individual3">
    <individual idref="individual4">
    <individual idref="individual10">
    <individual idref="individual8">
  </apsp>
  <apsp ploidylevel="1.0">
    <individual idref="individual4">
    <individual idref="individual2">
    <individual idref="individual10">
    <individual idref="individual1">
  </apsp>
  <geneTrees>
    <partitionedTreeModel idref="partitionedTreeModel1">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
    <treeModel idref="treeModel6">
    <gtree popfactor="1.0">
      <partitionedTreeModel idref="partitionedTreeModel9">
    </gtree>
    <gtree popfactor="1.0">
      <treeModel idref="treeModel10">
    </gtree>
    <gtree popfactor="1.0">
      <starTreeModel idref="starTreeModel1">
    </gtree>
  </geneTrees>
</alloppspecies>

`<alloppSpeciesNetwork>` element

Species network with population sizes along branches

The element takes following attributes:

oneHybridization (optional) is of type Boolean
diploidRootIsRoot (optional) is of type Boolean

The element has the following contents:

AlloppSpeciesBindings element (exactly one)
Element named <tipPopulations>

Containing:
- value (optional) is of type Double
- Parameter element (exactly one)
Element named <rootPopulations>

Containing:
- value (optional) is of type Double
- Parameter element (exactly one)
Element named <hybridPopulations>

Containing:
- value (optional) is of type Double
- Parameter element (exactly one)

Example:

<alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp8">
    <apsp idref="apsp1">
    <apsp idref="apsp8">
    <apsp idref="apsp1">
    <geneTrees>
      <partitionedTreeModel idref="partitionedTreeModel9">
      <starTreeModel idref="starTreeModel6">
      <starTreeModel idref="starTreeModel9">
    </geneTrees>
  </alloppspecies>
  <tipPopulations value="1.0">
    <maskedMatrixParameter idref="maskedMatrixParameter4">
  </tipPopulations>
  <rootPopulations value="1.0">
    <matrixVectorProductParameter idref="matrixVectorProductParameter2">
  </rootPopulations>
  <hybridPopulations value="1.0">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
  </hybridPopulations>
</alloppSpeciesNetwork>

`<alsTreeLikelihood>` element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

useAmbiguities (optional) is of type Boolean
storePartials (optional) is of type Boolean
integrateGainRate is of type Boolean
forceRescaling (optional) is of type Boolean

The element has the following contents:

Element named <immigrationRate>

Containing:
- Parameter element (exactly one)
PatternList element (exactly one)
TreeModel element (exactly one)
SiteModel element (exactly one)
BranchRateModel element (zero or one)
Element named <observationProcess>

Containing:
- type is of type String
- taxon (optional) is of type String

Example:

<alsTreeLikelihood useAmbiguities="true" storePartials="true" integrateGainRate="true" forceRescaling="true">
  <constantPatterns>
    <categoryOutbreak idref="categoryOutbreak3">
    <counts>
      <vectorSlice idref="vectorSlice8">
    </counts>
  </constantPatterns>
  <treeModel fixHeights="true" fixTree="true">
    <tree idref="tree5">
    <rootHeight>
      <duplicatedParameter idref="duplicatedParameter1">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundParameter idref="compoundParameter6">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter5">
    </nodeHeights>
    <leafHeight taxon="foo">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter1">
    </leafHeight>
    <leafHeight taxon="foo">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision5">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter8">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <copyParameterValues idref="copyParameterValues3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter6">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter3">
    </leafTrait>
  </treeModel>
  ERROR!
  <observationProcess type="foo" taxon="foo"/>
</alsTreeLikelihood>

`<aminoAcidModel>` element

An empirical amino acid substitution model.

The element takes following attributes:

type is of type String

“The type of empirical amino-acid rate matrix”

The element has the following contents:

Element named <frequencies>
If the frequencies are omitted than the empirical frequencies associated with the selected model are used.
Containing:
- FrequencyModel element (exactly one)

Example:

<aminoAcidModel type="blosum62"/>

`<ancestralTrait>` element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

name (optional) is of type String

“A name for this statistic primarily for the purposes of logging”
traitName (optional) is of type String

“The name of the trait to log”

The element has the following contents:

TreeModel element (exactly one)
TreeTraitProvider element (exactly one)
Element named <mrca>
The MRCA to reconstruct the trait at (default root node)
Containing:
- Taxa element (exactly one)

Example:

<ancestralTrait name="foo" traitName="foo">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <partitionedTreeModel idref="partitionedTreeModel6">
  </empiricalTreeDistributionModel>
  <attributeBranchRateModel rateAttribute="foo">
    <treeModel idref="treeModel6">
  </attributeBranchRateModel>
</ancestralTrait>

`<ancestralTrait>` element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

name (optional) is of type String

“A name for this statistic primarily for the purposes of logging”
traitName (optional) is of type String

“The name of the trait to log”

The element has the following contents:

TreeModel element (exactly one)
TreeTraitProvider element (exactly one)
Element named <mrca>
The MRCA to reconstruct the trait at (default root node)
Containing:
- Taxa element (exactly one)

Example:

<ancestralTrait name="foo" traitName="foo">
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork9">
    <rootHeight>
      <sumParameter idref="sumParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter2">
    </nodeHeights>
    <leafHeight taxon="foo">
      <diagonalMatrix idref="diagonalMatrix1">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix6">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundParameter idref="compoundParameter9">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter2">
    </leafTrait>
  </treeModel>
  <randomLocalYuleModel ratesAsMultipliers="true" dp="1" units="days">
    <birthRates>
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </birthRates>
    <indicators>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    </indicators>
    <meanRate>
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </meanRate>
  </randomLocalYuleModel>
</ancestralTrait>

`<ancestralTreeLikelihood>` element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

useAmbiguities (optional) is of type Boolean
stateTagName (optional) is of type String
scalingScheme (optional) is of type String
delayScaling (optional) is of type String

The element has the following contents:

PatternList element (exactly one)
TreeModel element (exactly one)
GammaSiteRateModel element (exactly one)
BranchModel element (zero or one)
BranchRateModel element (zero or one)
TipStatesModel element (zero or one)
SubstitutionModel element (zero or one)
Element named <partialsRestriction>

Containing:
- TaxonList element (exactly one)
- Parameter element (exactly one)
FrequencyModel element (zero or one)

Example:

<ancestralTreeLikelihood useAmbiguities="true" stateTagName="foo" scalingScheme="foo" delayScaling="foo">
  <convert dataType="nucleotide">
    <sequenceSimulator idref="sequenceSimulator2">
  </convert>
  <treeModel fixHeights="true" fixTree="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
    <rootHeight>
      <productParameter idref="productParameter4">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips7">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <differenceParameter idref="differenceParameter4">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter1">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <parameter idref="parameter10">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter5">
    </leafTrait>
  </treeModel>
  <siteModel>
    <relativeRate weight="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </relativeRate>
  </siteModel>
</ancestralTreeLikelihood>

`<antigenicDriftPrior>` element

Provides the likelihood of a vector of coordinates in some multidimensional ‘antigenic’ space based on an expected relationship with time.

The element has the following contents:

Element named <locations>

Containing:
- MatrixParameter element (exactly one)
Element named <offsets>

Containing:
- Parameter element (exactly one)
Element named <regressionSlope>

Containing:
- Parameter element (exactly one)
Element named <regressionPrecision>

Containing:
- Parameter element (exactly one)

Example:

<antigenicDriftPrior>
  <locations>
    <compoundMatrixParameter idref="compoundMatrixParameter2">
  </locations>
  <offsets>
    <differenceMatrixParameter idref="differenceMatrixParameter4">
  </offsets>
  <regressionSlope>
    <matrixParameter idref="matrixParameter9">
  </regressionSlope>
  <regressionPrecision>
    <compoundParameter idref="compoundParameter5">
  </regressionPrecision>
</antigenicDriftPrior>

`<antigenicLikelihood>` element

Provides the likelihood of immunological assay data such as Hemagglutinin inhibition (HI) given vectors of coordinatesfor viruses and sera/antisera in some multidimensional ‘antigenic’ space.

The element takes following attributes:

fileName is of type String

“The name of the file containing the assay table”
mdsDimension is of type Integer

“The dimension of the space for MDS”
mergeSerumIsolates (optional) is of type Boolean

“Should multiple serum isolates from the same strain have their locations merged (defaults to false)”
intervalWidth (optional) is of type Double

“The width of the titre interval in log 2 space”
driftInitialLocations (optional) is of type Double

“The degree to drift initial virus and serum locations, defaults to 0.0”

The element has the following contents:

Element named <tipTrait>
Optional parameter of tip locations from the tree
Containing:
- CompoundParameter element (exactly one)
Element named <virusLocations>
Parameter of locations of all virus
Containing:
- MatrixParameter element (exactly one)
Element named <serumLocations>
Parameter of locations of all sera
Containing:
- MatrixParameter element (exactly one)
Element named <virusOffsets>
Optional parameter for virus dates to be stored
Containing:
- Parameter element (exactly one)
Element named <serumOffsets>
Optional parameter for serum dates to be stored
Containing:
- Parameter element (exactly one)
Element named <serumPotencies>
Optional parameter for serum potencies
Containing:
- Parameter element (exactly one)
Element named <serumBreadths>
Optional parameter for serum breadths
Containing:
- Parameter element (exactly one)
Element named <virusAvidities>
Optional parameter for virus avidities
Containing:
- Parameter element (exactly one)
Element named <mdsPrecision>
Parameter for precision of MDS embedding
Containing:
- Parameter element (exactly one)
Element named <locationDrift>
Optional parameter for drifting locations with time
Containing:
- Parameter element (exactly one)
Element named <virusDrift>
Optional parameter for drifting only virus locations, overrides locationDrift
Containing:
- Parameter element (exactly one)
Element named <serumDrift>
Optional parameter for drifting only serum locations, overrides locationDrift
Containing:
- Parameter element (exactly one)

Example:

<antigenicLikelihood fileName="foo" mdsDimension="1" mergeSerumIsolates="true" intervalWidth="1.0" driftInitialLocations="1.0">
  <virusLocations>
    <mvPolyaLikelihood idref="mvPolyaLikelihood10">
  </virusLocations>
  <serumLocations>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
  </serumLocations>
  <mdsPrecision>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision7">
  </mdsPrecision>
</antigenicLikelihood>

`<appendedPotentialDerivative>` element

null

The element has the following contents:

GradientWrtParameterProvider elements (one or more)

Example:

<appendedPotentialDerivative>
  <gradient>
    <twoPartDistribution idref="twoPartDistribution6">
  </gradient>
  <sumDerivative>
    <sumDerivative idref="sumDerivative9">
    <sumDerivative idref="sumDerivative1">
    <gradient idref="gradient4">
    <gradient idref="gradient4">
  </sumDerivative>
  <sumDerivative>
    <appendedPotentialDerivative idref="appendedPotentialDerivative8">
  </sumDerivative>
  <maskedGradient>
    <sumDerivative idref="sumDerivative6">
    <mask>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser7">
    </mask>
  </maskedGradient>
</appendedPotentialDerivative>

`<approximateFactorAnalysisPrecision>` element

A diffusion approximation to a factor analysis

The element has the following contents:

Element named <L>

Containing:
- MatrixParameterInterface element (exactly one)
Element named <gamma>

Containing:
- Parameter element (exactly one)

Example:

<approximateFactorAnalysisPrecision>
  <L>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser3">
  </L>
  <gamma>
    <sumParameter idref="sumParameter5">
  </gamma>
</approximateFactorAnalysisPrecision>

`<apsp>` element

A diploid or allopolyploid species made of individuals

The element takes following attributes:

ploidylevel is of type Double

The element has the following contents:

AlloppSpeciesBindings$Individual elements (one or more)

Example:

<apsp ploidylevel="1.0">
  <individual>
    <apsp idref="apsp2">
  </individual>
</apsp>

`<apspCoalescent>` element

Likelihood of a set of gene trees embedded in a allopolyploid species network.

The element has the following contents:

AlloppSpeciesBindings element (exactly one)
AlloppSpeciesNetworkModel element (exactly one)

Example:

<apspCoalescent>
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp3">
    <apsp idref="apsp3">
    <apsp idref="apsp8">
    <apsp idref="apsp8">
    <geneTrees>
      <starTreeModel idref="starTreeModel7">
      <starTreeModel idref="starTreeModel8">
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
      </gtree>
      <gtree popfactor="1.0">
        <partitionedTreeModel idref="partitionedTreeModel10">
      </gtree>
      <gtree popfactor="1.0">
        <starTreeModel idref="starTreeModel10">
      </gtree>
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies3">
    <tipPopulations value="1.0">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser7">
    </tipPopulations>
    <rootPopulations value="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter7">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <fastMatrixParameter idref="fastMatrixParameter3">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</apspCoalescent>

`<apspNetworkPrior>` element

Prior for an allopolyploid species network.

The element has the following contents:

Element named <model>

Containing:
- AlloppNetworkPriorModel element (exactly one)
Element named <apspNetwork>

Containing:
- AlloppSpeciesNetworkModel element (exactly one)

Example:

<apspNetworkPrior>
  <model>
    <alloppNetworkPriorModel idref="alloppNetworkPriorModel2">
  </model>
  <apspNetwork>
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork7">
  </apspNetwork>
</apspNetworkPrior>

`<arbitraryBranchRates>` element

This element returns an arbitrary rate model.The branch rates are drawn from an arbitrary distribution determine by the prior.

The element takes following attributes:

reciprocal (optional) is of type Boolean
centerAtOne (optional) is of type Boolean
exp (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)
Element named <rates>
The rate parameter
Containing:
- Parameter element (exactly one)

Example:

<arbitraryBranchRates reciprocal="true" centerAtOne="true" exp="true">
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork5">
    <rootHeight>
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <complementParameter idref="complementParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <sumParameter idref="sumParameter8">
    </nodeHeights>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastMatrixParameter idref="fastMatrixParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceParameter idref="differenceParameter9">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter5">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <designMatrix idref="designMatrix9">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix7">
    </leafTrait>
  </treeModel>
  <rates>
    <dataFromTreeTips idref="dataFromTreeTips4">
  </rates>
</arbitraryBranchRates>

`<argCoalescentLikelihood>` element

A coalescent likelihood for an ARG model

The element takes following attributes:

ancestralRestriction (optional) is of type Boolean

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <recombinationRate>

Containing:
- Parameter element (exactly one)
Element named <argModel>

Containing:
- ARGModel element (exactly one)

Example:

<argCoalescentLikelihood ancestralRestriction="true">
  <populationSize>
    <jointParameter idref="jointParameter8">
  </populationSize>
  <recombinationRate>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
  </recombinationRate>
  <argModel>
    <argTreeModel idref="argTreeModel2">
  </argModel>
</argCoalescentLikelihood>

`<argDiscretizedBranchRates>` element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.

The element takes following attributes:

numRateCategories is of type Integer

The element has the following contents:

ARGModel element (exactly one)
Element named <distribution>
The distribution model for rates among branches
Containing:
- ParametricDistributionModel element (exactly one)

Example:

<argDiscretizedBranchRates numRateCategories="1">
  <argTreeModel partitionType="recombination">
    <newick idref="newick9">
    <rootHeight>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <fastMatrixParameter idref="fastMatrixParameter5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter5">
    </nodeHeights>
  </argTreeModel>
  <distribution>
    <uniformDistributionModel idref="uniformDistributionModel10">
  </distribution>
</argDiscretizedBranchRates>

`<ARGEventOperator>` element

An operator that slides a subarg.

The element takes following attributes:

addProbability is of type Double

“The probability that the operator adds a new reassortment event”
jointPartitioning (optional) is of type Boolean
tossSize (optional) is of type Integer
addProbability (optional) is of type Double
autoOptimize (optional) is of type Boolean
weight is of type Integer

The element has the following contents:

ARGModel element (exactly one)
ARGPartitionLikelihood element (exactly one)
ARGRatePrior element (zero or one)
Element named <internalNodes>

Containing:
- CompoundParameter element (exactly one)
Element named <internalNodesPlusRoot>

Containing:
- CompoundParameter element (exactly one)
Element named <nodeRates>

Containing:
- CompoundParameter element (exactly one)

Example:

<ARGEventOperator addProbability="1.0" jointPartitioning="true" tossSize="1" addProbability="1.0" autoOptimize="true" weight="1">
  <argTreeModel partitionType="recombination">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
    <rootHeight>
      <sumParameter idref="sumParameter6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix1">
    </nodeHeights>
  </argTreeModel>
  <poissonPartitionLikelihood mean="1.0">
    <argTreeModel idref="argTreeModel5">
  </poissonPartitionLikelihood>
  <internalNodes>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser9">
  </internalNodes>
  <internalNodesPlusRoot>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView8">
  </internalNodesPlusRoot>
  <nodeRates>
    <matrixParameter idref="matrixParameter5">
  </nodeRates>
</ARGEventOperator>

`<argLocalClock>` element

null

Example:

<argLocalClock/>

`<argTreeModel>` element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.

The element takes following attributes:

partitionType (optional) is of type String

“Describes the partition structure of the model”

The element has the following contents:

Tree element (exactly one)
Element named <rootHeight>
A parameter definition with id only (cannot be a reference!)
Containing:
- Parameter element (exactly one)
Element named <nodeHeights>

Containing:
- rootNode (optional) is of type Boolean
  
  “If true the root height is included in the parameter”
- internalNodes (optional) is of type Boolean
  
  “If true the internal node heights (minus the root) are included in the parameter”
- Parameter element (exactly one)
  
  A parameter definition with id only (cannot be a reference!)

Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>```



### <code>&lt;argNarrowExchange&gt;</code> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

* <code>weight</code>  is of type [Integer](#integer)
: 

The element has the following contents:

* [ARGModel](#argmodel) element (exactly one)

Example:

```html
<argNarrowExchange weight="1">
  <argTreeModel partitionType="recombination">
    <tree idref="tree8">
    <rootHeight>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    </nodeHeights>
  </argTreeModel>
</argNarrowExchange>

`<argPartitionOperator>` element

An operator that picks a new partitioning uniformly at random.

The element takes following attributes:

weight is of type Integer
tossSize (optional) is of type Integer
tossAll (optional) is of type Boolean

The element has the following contents:

ARGModel element (exactly one)

Example:

<argPartitionOperator weight="1" tossSize="1" tossAll="true">
  <argTreeModel partitionType="recombination">
    <speciesTree idref="speciesTree3">
    <rootHeight>
      <fastMatrixParameter idref="fastMatrixParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
    </nodeHeights>
  </argTreeModel>
</argPartitionOperator>

`<argRatePrior>` element

null

Example:

<argRatePrior/>

`<argReassortmentNodeCount>` element

A statistic that returns the number of reassortment nodes in an ARG

The element takes following attributes:

name (optional) is of type String

“A name for this statistic for the purpose of logging”

The element has the following contents:

ARGModel element (exactly one)

Example:

<argReassortmentNodeCount name="foo">
  <argTreeModel partitionType="recombination">
    <argTreeModel idref="argTreeModel6">
    <rootHeight>
      <leafTraitParameter idref="leafTraitParameter5">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </nodeHeights>
  </argTreeModel>
</argReassortmentNodeCount>

`<argSubtreeSlide>` element

An operator that slides a subtree.

The element takes following attributes:

weight is of type Integer
size is of type Double
gaussian is of type Boolean
swapRates (optional) is of type Boolean
swapTraits (optional) is of type Boolean
autoOptimize (optional) is of type Boolean

The element has the following contents:

ARGModel element (exactly one)

Example:

<argSubtreeSlide weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel partitionType="recombination">
    <speciesTree idref="speciesTree4">
    <rootHeight>
      <mvPolyaLikelihood idref="mvPolyaLikelihood2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter6">
    </nodeHeights>
  </argTreeModel>
</argSubtreeSlide>

`<argSwapOperator>` element

Swaps nodes on a tree

The element takes following attributes:

weight is of type Integer
type is of type String

“The mode of the operator”

The element has the following contents:

ARGModel element (exactly one)

Example:

<argSwapOperator weight="1" type="narrowSwap">
  <argTreeModel partitionType="recombination">
    <rescaledTree idref="rescaledTree4">
    <rootHeight>
      <copyParameterValues idref="copyParameterValues9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <differenceMatrixParameter idref="differenceMatrixParameter5">
    </nodeHeights>
  </argTreeModel>
</argSwapOperator>

`<argTimingStatistic>` element

The element takes following attributes:

name (optional) is of type String

The element has the following contents:

ARGModel element (exactly one)

Example:

<argTimingStatistic name="foo">
  <argTreeModel partitionType="recombination">
    <mulSpeciesTree idref="mulSpeciesTree9">
    <rootHeight>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips5">
    </nodeHeights>
  </argTreeModel>
</argTimingStatistic>

`<argTotalLengthStatistic>` element

null

Example:

<argTotalLengthStatistic/>

`<argTraceAnalysis>` element

Analyses and reports on a trace consisting of trees.

The element takes following attributes:

fileName is of type String

“name of a tree log file”
burnIn (optional) is of type Integer

Example:

<argTraceAnalysis fileName="trees.log" burnIn="1"/>

`<argTreeCount>` element

Provides number of distinct loci trees

The element has the following contents:

ARGModel element (exactly one)

Example:

<argTreeCount>
  <argTreeModel partitionType="recombination">
    <newick idref="newick7">
    <rootHeight>
      <complementParameter idref="complementParameter7">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    </nodeHeights>
  </argTreeModel>
</argTreeCount>

`<argTreeLikelihood>` element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

useAmbiguities (optional) is of type Boolean
storePartials (optional) is of type Boolean
useScaling (optional) is of type Boolean

The element has the following contents:

PatternList element (exactly one)
ARGModel element (exactly one)
SiteModel element (exactly one)
BranchRateModel element (zero or one)

Example:

<argTreeLikelihood useAmbiguities="true" storePartials="true" useScaling="true">
  <ascertainedPatterns from="1" to="1" every="1">
    <sequenceSimulator idref="sequenceSimulator5">
  </ascertainedPatterns>
  <argTreeModel partitionType="reassortment">
    <speciesTree idref="speciesTree5">
    <rootHeight>
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter1">
    </nodeHeights>
  </argTreeModel>
  ERROR!
</argTreeLikelihood>

`<argTreeModel>` element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.

The element takes following attributes:

partitionType (optional) is of type String

“Describes the partition structure of the model”

The element has the following contents:

Tree element (exactly one)
Element named <rootHeight>
A parameter definition with id only (cannot be a reference!)
Containing:
- Parameter element (exactly one)
Element named <nodeHeights>

Containing:
- rootNode (optional) is of type Boolean
  
  “If true the root height is included in the parameter”
- internalNodes (optional) is of type Boolean
  
  “If true the internal node heights (minus the root) are included in the parameter”
- Parameter element (exactly one)
  
  A parameter definition with id only (cannot be a reference!)

Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>```



### <code>&lt;argUniformPrior&gt;</code> element

A uniform prior for an ARG model

The element has the following contents:

* [ARGModel](#argmodel) element (exactly one)

Example:

```html
<argUniformPrior>
  <argTreeModel partitionType="reassortment">
    <argTreeModel idref="argTreeModel5">
    <rootHeight>
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <parameter idref="parameter5">
    </nodeHeights>
  </argTreeModel>
</argUniformPrior>

`<argWideExchange>` element

This element represents a wide exchange operator. This operator swaps two random subtrees.

The element takes following attributes:

weight is of type Integer

The element has the following contents:

ARGModel element (exactly one)

Example:

<argWideExchange weight="1">
  <argTreeModel partitionType="reassortment">
    <speciesTree idref="speciesTree6">
    <rootHeight>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice6">
    </nodeHeights>
  </argTreeModel>
</argWideExchange>

`<arithmeticMeanAnalysis>` element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

fileName is of type String

“The traceName of a BEAST log file (can not include trees, which should be logged separately”
burnIn (optional) is of type Integer
bootstrapLength (optional) is of type Integer

The element has the following contents:

Element named <likelihoodColumn>

Containing:
- name is of type String
  
  “The column name”

Example:

<arithmeticMeanAnalysis fileName="foo" burnIn="1" bootstrapLength="1">
  <likelihoodColumn name="foo"/>
</arithmeticMeanAnalysis>

`<array>` element

This element returns an array of the objects it contains.

The element has the following contents:

Object elements (one or more)

Objects to be put in an array

Example:

<array>
  <hiddenNucleotides classCount="1"/>
  <precisionGibbsOperator weight="1.0">
    <treeTraitNormalDistributionLikelihood idref="treeTraitNormalDistributionLikelihood2">
  </precisionGibbsOperator>
</array>

`<ascertainedPatterns>` element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element takes following attributes:

from (optional) is of type Integer

“The site position to start at, default is 1 (the first position)”
to (optional) is of type Integer

“The site position to finish at, must be greater than from, default is length of given alignment”
every (optional) is of type Integer

“Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)”

The element has the following contents:

Element named <taxonList>

Containing:
- TaxonList element (exactly one)
Alignment element (exactly one)

:: Example:

<ascertainedPatterns from="1" to="1" every="1">
  <alignment>
    <kStateType idref="kStateType2">
    <sequence idref="sequence8">
    <sequence idref="sequence3">
    <sequence idref="sequence5">
    <sequence idref="sequence8">
  </alignment>
</ascertainedPatterns>

`<attr>` element

This element represents a name/value pair.

The element takes following attributes:

name is of type String

“The name to give to this attribute”

The element has the following contents:

Object element (exactly one)

Example:

<attr name="foo">
  <mulSpeciesTree constantRoot="true" constantPopulation="true">
    <mulSpecies idref="mulSpecies4">
    <sppSplitPopulations value="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    </sppSplitPopulations>
  </mulSpeciesTree>
</attr>

`<attributeBranchRateModel>` element

This element returns a branch rate model.The branch rates are specified by an attribute embedded in the nodes of the tree.

The element takes following attributes:

rateAttribute is of type String

“Optional name of a rate attribute to be read with the trees”

The element has the following contents:

TreeModel element (exactly one)

Example:

<attributeBranchRateModel rateAttribute="foo">
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork1">
    <rootHeight>
      <copyParameterValues idref="copyParameterValues5">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter4">
    </nodeHeights>
    <leafHeight taxon="foo">
      <compoundMatrixParameter idref="compoundMatrixParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <sumParameter idref="sumParameter5">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixMatrixProduct idref="matrixMatrixProduct4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix1">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <duplicatedParameter idref="duplicatedParameter2">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixMatrixProduct idref="matrixMatrixProduct10">
    </nodeTraits>
    <leafTrait taxon="foo" name="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix7">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <designMatrix idref="designMatrix8">
    </leafTrait>
  </treeModel>
</attributeBranchRateModel>

`<attributePatterns>` element

A site pattern defined by an attribute in a set of taxa.

The element takes following attributes:

attribute is of type String
secondary (optional) is of type String

The element has the following contents:

One of:
- dataType is of type String
  
  “The data type”
- DataType element (exactly one)
TaxonList element (exactly one)

The taxon set

Example:

<attributePatterns dataType="hiddenAminoAcid2" attribute="foo" secondary="foo">
  <hypermutantAlignment type="both">
    <sequenceSimulator idref="sequenceSimulator7">
  </hypermutantAlignment>
</attributePatterns>

`<attributes>` element

This element represents an array of name/value pairs.

The element takes following attributes:

names is of type String;
values is of type String;

Example:

<attributes names="foo bar" values="foo bar"/>

`<bdcNClustersStatistic>` element

Statistic for number of collapsed nodes in species tree when using birth-death-collapse model.

The element takes following attributes:

name is of type String

The element has the following contents:

Element named <speciesTree>

Containing:
- SpeciesTreeModel element (exactly one)
Element named <collapseModel>

Containing:
- BirthDeathCollapseModel element (exactly one)

Example:

<bdcNClustersStatistic name="foo">
  <speciesTree>
    <speciesTree idref="speciesTree6">
  </speciesTree>
  <collapseModel>
    <birthDeathCollapseModel idref="birthDeathCollapseModel8">
  </collapseModel>
</bdcNClustersStatistic>

`<beagleBranchLikelihood>` element

beagleBranchLikelihood

Example:

<beagleBranchLikelihood/>

`<beagleOperationReport>` element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

branchFileName (optional) is of type String
operationFileName (optional) is of type String

The element has the following contents:

PatternList elements (exactly 2)
TreeModel element (exactly one)
BranchRateModel element (exactly one)
GammaSiteRateModel element (exactly one)

Example:

<beagleOperationReport branchFileName="foo" operationFileName="foo">
  <maskedPatterns negative="true">
    <alignment idref="alignment9">
    <mask>
      foo
    </mask>
  </maskedPatterns>
  <convert dataType="nucleotide">
    <alignment idref="alignment2">
  </convert>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <patterns idref="patterns6">
  </empiricalTreeDistributionModel>
  <epochBranchModel>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5">
    <empiricalCodonModel idref="empiricalCodonModel2">
    <epoch transitionTime="1.0">
      <binaryCovarionModel idref="binaryCovarionModel1">
    </epoch>
    <epoch transitionTime="1.0">
      <complexSubstitutionModel idref="complexSubstitutionModel4">
    </epoch>
    <epoch transitionTime="1.0">
      <binarySubstitutionModel idref="binarySubstitutionModel7">
    </epoch>
    <epoch transitionTime="1.0">
      <museGautCodonModel idref="museGautCodonModel5">
    </epoch>
  </epochBranchModel>
  <siteModel>
    <relativeRate weight="1.0">
      <leafTraitParameter idref="leafTraitParameter10">
    </relativeRate>
  </siteModel>
</beagleOperationReport>

`<benchmarker>` element

This element runs a benchmark on a series of likelihood calculators.

The element takes following attributes:

iterationCount is of type Integer

The element has the following contents:

Likelihood elements (one or more)

Example:

<benchmarker iterationCount="1">
  <empiricalDistributionLikelihood fileName="foo" splineInterpolation="true" degree="1" inverse="true" readByColumn="true">
    <data from="1" to="1" offset="1.0" lower="1.0" upper="1.0">
      <partitionStatistic idref="partitionStatistic3">
      <treeMetricStatistic idref="treeMetricStatistic10">
      <statistic idref="statistic3">
      <argTotalLengthStatistic idref="argTotalLengthStatistic5">
    </data>
  </empiricalDistributionLikelihood>
  <modelSpecificPseudoPrior/>
</benchmarker>

`<betaDistributionModel>` element

A model of a beta distribution.

The element has the following contents:

One of:
- Element named <alpha>
  
  Containing:
  - Double element (exactly one)
- Element named <alpha>
  
  Containing:
  - Parameter element (exactly one)
One of:
- Element named <beta>
  
  Containing:
  - Double element (exactly one)
- Element named <beta>
  
  Containing:
  - Parameter element (exactly one)

Example:

<betaDistributionModel>
  <alpha>
    <parameter idref="parameter6">
  </alpha>
  <beta>
    1.0
  </beta>
</betaDistributionModel>

`<betaPrior>` element

Calculates the prior probability of some data under a given beta distribution.

The element takes following attributes:

shape is of type Double
shapeB is of type Double
offset (optional) is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<betaPrior shape="1.0" shapeB="1.0" offset="1.0">
  <correlation dimension1="1" dimension2="1">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
  </correlation>
</betaPrior>

`<betaSplittingModel>` element

The beta-splitting family of tree branching models (Aldous, 1996;2001).

The element has the following contents:

Element named <phi>
A parameter that ranges from -infinity (comb-tree) to +infinity (balanced tree)
Containing:
- Parameter element (exactly one)
Element named <branchingTree>

Containing:
- Tree element (exactly one)

Example:

<betaSplittingModel>
  <phi>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
  </phi>
  <branchingTree>
    <newick idref="newick8">
  </branchingTree>
</betaSplittingModel>

`<biasedMultivariateDiffusionModel>` element

Describes a multivariate normal diffusion process.

The element has the following contents:

Element named <precisionMatrix>

Containing:
- MatrixParameter element (exactly one)
Element named <biasParameter>

Containing:
- Parameter element (exactly one)

Example:

<biasedMultivariateDiffusionModel>
  <precisionMatrix>
    <diagonalMatrix idref="diagonalMatrix1">
  </precisionMatrix>
  <biasParameter>
    <complementParameter idref="complementParameter2">
  </biasParameter>
</biasedMultivariateDiffusionModel>

`<bifractionalDiffusionModel>` element

Describes a bivariate diffusion process using a bifractional random walk

The element has the following contents:

Element named <alpha>

Containing:
- Parameter element (exactly one)
Element named <beta>

Containing:
- Parameter element (exactly one)

Example:

<bifractionalDiffusionModel>
  <alpha>
    <maskedMatrixParameter idref="maskedMatrixParameter1">
  </alpha>
  <beta>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
  </beta>
</bifractionalDiffusionModel>

`<binaryCovarionModel>` element

A covarion substitution model on binary data and a hidden rate state with two rates.

The element takes following attributes:

version (optional) is of type String

The element has the following contents:

Element named <frequencies>

Containing:
- Parameter element (exactly one)
Element named <hiddenFrequencies>

Containing:
- Parameter element (exactly one)
Element named <alpha>

Containing:
- Parameter element (zero or one)
Element named <switchingRate>

Containing:
- Parameter element (zero or one)

Example:

<binaryCovarionModel version="foo">
  <frequencies>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix10">
  </frequencies>
  <hiddenFrequencies>
    <diagonalMatrix idref="diagonalMatrix4">
  </hiddenFrequencies>
  <alpha/>
  <switchingRate/>
</binaryCovarionModel>

`<binarySubstitutionModel>` element

A general reversible model of sequence substitution for binary data type.

The element has the following contents:

Element named <frequencies>

Containing:
- FrequencyModel element (exactly one)

Example:

<binarySubstitutionModel>
  <frequencies>
    <frequencyModel idref="frequencyModel2">
  </frequencies>
</binarySubstitutionModel>

`<binomialLikelihood>` element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element takes following attributes:

onLogitScale (optional) is of type Boolean

The element has the following contents:

Element named <counts>

Containing:
- Parameter element (exactly one)
Element named <proportion>

Containing:
- Parameter element (exactly one)
One of:
- Element named <trials>
  
  Containing:
  - values is of type Integer;
- Element named <trials>
  
  Containing:
  - Parameter element (exactly one)

Example:

<binomialLikelihood onLogitScale="true">
  <counts>
    <copyParameterValues idref="copyParameterValues9">
  </counts>
  <proportion>
    <complementParameter idref="complementParameter10">
  </proportion>
  <trials values="1 2 4 8"/>
</binomialLikelihood>

`<birthDeathCollapseModel>` element

A speciation model aimed at species delimitation, mixing birth-death model with spike near zero for node heights.

The element takes following attributes:

units is of type String

“the units”
collapseHeight is of type Double

The element has the following contents:

Element named <speciesTree>

Containing:
- Tree element (exactly one)
Element named <birthMinusDeathRate>

Containing:
- Parameter element (exactly one)
Element named <relativeDeathRate>

Containing:
- Parameter element (exactly one)
Element named <originHeight>

Containing:
- Parameter element (exactly one)
Element named <collapseWeight>

Containing:
- Parameter element (exactly one)

Example:

<birthDeathCollapseModel units="months" collapseHeight="1.0">
  <speciesTree>
    <argTreeModel idref="argTreeModel8">
  </speciesTree>
  <birthMinusDeathRate>
    <maskedParameter idref="maskedParameter8">
  </birthMinusDeathRate>
  <relativeDeathRate>
    <vectorSlice idref="vectorSlice6">
  </relativeDeathRate>
  <originHeight>
    <fastMatrixParameter idref="fastMatrixParameter6">
  </originHeight>
  <collapseWeight>
    <immutableParameter idref="immutableParameter5">
  </collapseWeight>
</birthDeathCollapseModel>

`<birthDeathEpidemiology>` element

Stadler et al (2011) model of epidemiology.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <origin>
The origin of the infection, x0 > tree.rootHeight
Containing:
- Parameter element (exactly one)
Element named <R0>

Containing:
- Parameter element (exactly one)
Element named <recoveryRate>

Containing:
- Parameter element (exactly one)
Element named <samplingProbability>

Containing:
- Parameter element (exactly one)

Example:

<birthDeathEpidemiology units="days">
  <R0>
    <immutableParameter idref="immutableParameter7">
  </R0>
  <recoveryRate>
    <mvPolyaLikelihood idref="mvPolyaLikelihood2">
  </recoveryRate>
  <samplingProbability>
    <dataFromTreeTips idref="dataFromTreeTips4">
  </samplingProbability>
</birthDeathEpidemiology>

`<birthDeathModel>` element

Gernhard (2008) model of speciation (equation at bottom of page 19 of draft).

The element takes following attributes:

type (optional) is of type String
conditionalOnRoot (optional) is of type Boolean
units is of type String

“the units”

The element has the following contents:

Element named <birthMinusDeathRate>

Containing:
- Parameter element (exactly one)
Element named <relativeDeathRate>

Containing:
- Parameter element (exactly one)
Element named <sampleProbability>

Containing:
- Parameter element (exactly one)

Example:

<birthDeathModel type="foo" conditionalOnRoot="true" units="years">
  <birthMinusDeathRate>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView6">
  </birthMinusDeathRate>
  <relativeDeathRate>
    <differenceParameter idref="differenceParameter2">
  </relativeDeathRate>
</birthDeathModel>

`<birthDeathSerialSampling>` element

Stadler et al (2010) model of speciation.

The element takes following attributes:

type (optional) is of type String
hasFinalSample (optional) is of type Boolean

The element has the following contents:

Element named <origin>
The origin of the infection, x0 > tree.rootHeight
Containing:
- Parameter element (exactly one)
Element named <birthRate>

Containing:
- Parameter element (exactly one)
One of:
- Element named <deathRate>
  
  Containing:
  - Parameter element (exactly one)
- Element named <relativeDeathRate>
  
  Containing:
  - Parameter element (exactly one)
Element named <psi>

Containing:
- Parameter element (exactly one)
Element named <sampleBecomesNonInfectiousProb>

Containing:
- Parameter element (exactly one)

Example:

<birthDeathSerialSampling type="foo" hasFinalSample="true">
  <birthRate>
    <copyParameterValues idref="copyParameterValues1">
  </birthRate>
  <deathRate>
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
  </deathRate>
  <psi>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView7">
  </psi>
</birthDeathSerialSampling>

`<bitFlipInSubstitutionModelOperator>` element

This element returns a bit-flip operator on a given indicatorParameter.

The element takes following attributes:

weight is of type Double
scaleFactor is of type Double
autoOptimize (optional) is of type Boolean

The element has the following contents:

Parameter element (zero or one)
BayesianStochasticSearchVariableSelection element (exactly one)

Example:

<bitFlipInSubstitutionModelOperator weight="1.0" scaleFactor="1.0" autoOptimize="true">
  <complexSubstitutionModel randomizeIndicator="true" bssvsTolerance="1.0" bssvsScalar="1.0" checkConditioning="true" normalized="true">
    <microsatellite idref="microsatellite2">
    <frequencies>
      <frequencyModel idref="frequencyModel9">
    </frequencies>
    <rates/>
  </complexSubstitutionModel>
</bitFlipInSubstitutionModelOperator>

`<bitFlipOperator>` element

This element returns a bit-flip operator on a given parameter.

The element takes following attributes:

weight is of type Double
usesPriorOnSum (optional) is of type Boolean

The element has the following contents:

TreeModel element (zero or one)
Parameter element (exactly one)

Example:

<bitFlipOperator weight="1.0" usesPriorOnSum="true">
  <maskedParameter complement="true" build="true" from="1" to="1" every="1">
    <compoundParameter idref="compoundParameter4">
  </maskedParameter>
</bitFlipOperator>

`<bitMoveOperator>` element

This element returns a bit-move operator on a given parameter.

The element takes following attributes:

weight is of type Double
numBitsToMove is of type Integer

The element has the following contents:

Element named <bits>

Containing:
- Parameter element (exactly one)
Element named <values>
values parameter
Containing:
- Parameter element (exactly one)

Example:

<bitMoveOperator weight="1.0" numBitsToMove="1">
  <bits>
    <leafTraitParameter idref="leafTraitParameter3">
  </bits>
</bitMoveOperator>

`<bitSwapOperator>` element

This element returns a bit-swap operator on a given parameter and data.

The element takes following attributes:

weight is of type Double
radius (optional) is of type Double

The element has the following contents:

Element named <data>

Containing:
- Statistic element (exactly one)
Element named <indicators>

Containing:
- Statistic element (exactly one)

Example:

<bitSwapOperator weight="1.0" radius="1.0">
  <data>
    <continuousDiffusionStatistic idref="continuousDiffusionStatistic8">
  </data>
  <indicators>
    <driftedLocationsStatistic idref="driftedLocationsStatistic1">
  </indicators>
</bitSwapOperator>

`<blockUpperTriangularMatrixParameter>` element

Returns a blockUpperTriangularMatrixParameter which is a compoundParameter which forces the last element to be of full length, the second to last element to be of full length-1, etc.

The element takes following attributes:

transpose (optional) is of type Boolean
columnDimension (optional) is of type Integer
diagonalRestriction (optional) is of type Boolean

The element has the following contents:

Parameter elements (zero or more)

Example:

<blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true">
  <diagonalMatrix>
    <copyParameterValues idref="copyParameterValues10">
  </diagonalMatrix>
  <markovRandomFieldMatrix asCorrelation="true" dim="1">
    <diagonal>
      <differenceParameter idref="differenceParameter6">
    </diagonal>
    <offDiagonal>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix1">
    </offDiagonal>
    <nugget>
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </nugget>
  </markovRandomFieldMatrix>
  <mvPolyaLikelihood>
    <data>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </data>
    <frequencies>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
    </frequencies>
  </mvPolyaLikelihood>
  <duplicatedParameter>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    <copies>
      <designMatrix idref="designMatrix3">
    </copies>
  </duplicatedParameter>
</blockUpperTriangularMatrixParameter>

`<booleanLikelihood>` element

A function that log likelihood of a set of boolean statistics. If all the statistics are true then it returns 0.0 otherwise -infinity.

The element has the following contents:

BooleanStatistic elements (one or more)

Example:

<booleanLikelihood>
  <monophylyStatistic name="foo" inverse="true">
    <upgmaTree idref="upgmaTree3">
    <mrca>
      <taxa idref="taxa3">
    </mrca>
  </monophylyStatistic>
  <notBooleanStatistic>
    <monophylyStatistic idref="monophylyStatistic3">
  </notBooleanStatistic>
  <compatibilityStatistic name="foo">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork8">
    <compatibleWith>
      <transformedTreeModel idref="transformedTreeModel10">
    </compatibleWith>
    <neighborJoiningTree idref="neighborJoiningTree9">
  </compatibilityStatistic>
</booleanLikelihood>

`<branchAssignmentModel>` element

This element provides a branch model which assigns substitution models to branches on the tree

The element has the following contents:

TreeModel element (exactly one)
Element named <assignment>

Containing:
- annotationValue is of type Integer
- SubstitutionModel element (exactly one)
Element named <baseModel>

Containing:
- SubstitutionModel element (exactly one)

Example:

<branchAssignmentModel>
  <treeModel fixHeights="true" fixTree="true">
    <upgmaTree idref="upgmaTree1">
    <rootHeight>
      <matrixMatrixProduct idref="matrixMatrixProduct7">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix2">
    </nodeHeights>
    <leafHeight taxon="foo">
      <dataFromTreeTips idref="dataFromTreeTips8">
    </leafHeight>
    <leafHeight taxon="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix10">
    </leafHeight>
    <leafHeight taxon="foo">
      <differenceParameter idref="differenceParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <mvPolyaLikelihood idref="mvPolyaLikelihood10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundMatrixParameter idref="compoundMatrixParameter2">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <complementParameter idref="complementParameter3">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix8">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <duplicatedParameter idref="duplicatedParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter9">
    </leafTrait>
  </treeModel>
  <assignment annotationValue="1">
    <hkyModel idref="hkyModel9">
  </assignment>
  <assignment annotationValue="1">
    <markovModulatedSubstitutionModel idref="markovModulatedSubstitutionModel9">
  </assignment>
  <assignment annotationValue="1">
    <markovModulatedYangCodonModel idref="markovModulatedYangCodonModel10">
  </assignment>
  <assignment annotationValue="1">
    <glmSubstitutionModelNew idref="glmSubstitutionModelNew3">
  </assignment>
  <baseModel>
    <TN93Model idref="TN93Model4">
  </baseModel>
</branchAssignmentModel>

`<branchCategories>` element

This element provides a set of branch categories.

The element takes following attributes:

randomize (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)
Element named <rateCategories>
Allocation parameter
Containing:
- Parameter element (exactly one)
Element named <clade>

Containing:
- category is of type Integer
- includeStem (optional) is of type Boolean
  
  “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
- excludeClade (optional) is of type Boolean
  
  “determines whether to exclude actual branches of the clade from the siteModel (default false).”
- Taxa element (exactly one)
  
  A set of taxa which defines a clade to apply a different site model to
Element named <trunk>

Containing:
- category is of type Integer
- includeStem (optional) is of type Boolean
  
  “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
- excludeClade (optional) is of type Boolean
  
  “determines whether to exclude actual branches of the clade from the siteModel (default false).”
- Taxa element (exactly one)
  
  A set of taxa which defines a clade to apply a different site model to

Example:

<branchCategories randomize="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <ascertainedPatterns idref="ascertainedPatterns1">
  </empiricalTreeDistributionModel>
  <rateCategories>
    <vectorSlice idref="vectorSlice8">
  </rateCategories>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa3">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa2">
  </clade>
  <trunk category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa9">
  </trunk>
</branchCategories>

`<branchDirections>` element

null

The element has the following contents:

SampledMultivariateTraitLikelihood element (exactly one)

Example:

<branchDirections>
  ERROR!
</branchDirections>

`<branchingLikelihood>` element

This element represents the likelihood of the tree given the demographic function.

The element has the following contents:

Element named <model>

Containing:
- BranchingModel element (exactly one)
Element named <branchingTree>

Containing:
- TreeModel element (exactly one)

Example:

<branchingLikelihood>
  <model>
    <betaSplittingModel idref="betaSplittingModel4">
  </model>
  <branchingTree>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
  </branchingTree>
</branchingLikelihood>

`<branchMagnitudes>` element

null

The element takes following attributes:

scaleByLength (optional) is of type Boolean

The element has the following contents:

AbstractMultivariateTraitLikelihood element (exactly one)

Example:

<branchMagnitudes scaleByLength="true">
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <immutableParameter idref="immutableParameter5">
    </traitParameter>
    <bifractionalDiffusionModel idref="bifractionalDiffusionModel9">
    <starTreeModel idref="starTreeModel1">
    ERROR!
    ERROR!
  </multivariateTraitLikelihood>
</branchMagnitudes>

`<branchSpecificSubstitutionModel>` element

This element provides a branch model which allows different substitution modelson different parts of the tree.

The element has the following contents:

TreeModel element (exactly one)

The tree
SubstitutionModel element (exactly one)

The substitution model for branches not explicitly included
Element named <externalBranches>

Containing:
- Taxa element (exactly one)
  
  A substitution model will be applied to the external branches for these taxa
- SubstitutionModel element (exactly one)
  
  The substitution model
Element named <clade>

Containing:
- stemWeight (optional) is of type Double
  
  “What proportion of the stem branch to include [0 <= w <= 1] (default 0).”
- Taxa element (exactly one)
  
  A set of taxa which defines a clade to apply a different site model to
- SubstitutionModel element (exactly one)
  
  The substitution model
Element named <backbone>

Containing:
- Taxa element (exactly one)
  
  A substitution model will be applied only to the ‘backbone’ branches defined by these taxa.
- SubstitutionModel element (exactly one)
  
  The substitution model

Example:

<branchSpecificSubstitutionModel>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <mergePatterns idref="mergePatterns9">
  </empiricalTreeDistributionModel>
  <lewisMk totalOrder="true">
    <frequencies>
      <frequencyModel idref="frequencyModel2">
    </frequencies>
  </lewisMk>
  <backbone>
    <taxa idref="taxa6">
    <markovModulatedYangCodonModel idref="markovModulatedYangCodonModel7">
  </backbone>
  <backbone>
    <taxa idref="taxa6">
    <complexSubstitutionModel idref="complexSubstitutionModel5">
  </backbone>
  <backbone>
    <taxa idref="taxa9">
    <aminoAcidModel idref="aminoAcidModel1">
  </backbone>
</branchSpecificSubstitutionModel>

`<branchSpecificTrait>` element

branchSpecificTrait

The element has the following contents:

BranchModel element (exactly one)
TreeModel element (exactly one)

Example:

<branchSpecificTrait>
  <randomBranchModel rate="1.0">
    <starTreeModel idref="starTreeModel7">
    <baseSubstitutionModel>
      <gtrModel idref="gtrModel6">
    </baseSubstitutionModel>
  </randomBranchModel>
  <starTreeModel>
    <argTreeModel idref="argTreeModel7">
    <sharedRootHeight>
      <treeModel idref="treeModel8">
    </sharedRootHeight>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
    </leafHeight>
    <leafHeight taxon="foo">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </leafHeight>
  </starTreeModel>
</branchSpecificTrait>

`<BrownianMotion>` element

The element takes following attributes:

logUnits (optional) is of type Boolean

The element has the following contents:

One of:
- Element named <sigma>
  
  Containing:
  - Double element (exactly one)
- Element named <sigma>
  
  Containing:
  - Parameter element (exactly one)
VariableDemographicModel element (exactly one)

Example:

<BrownianMotion logUnits="true">
  <sigma>
    1.0
  </sigma>
  <variableDemographic type="foo" logUnits="true" useMidpoints="true">
    <populationSizes>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
    </populationSizes>
    <indicators>
      <leafTraitParameter idref="leafTraitParameter4">
    </indicators>
    <trees>
      <ptree ploidy="1.0">
        <partitionedTreeModel idref="partitionedTreeModel6">
      </ptree>
    </trees>
  </variableDemographic>
</BrownianMotion>

`<buildCompoundSymmetricMatrix>` element

Returns a compound symmetric Matrix Parameter that is flexible, i.e. when exposed to a transition kernel can yield a result that is not compound symmetric

Example:

<buildCompoundSymmetricMatrix/>

`<cachedPrior>` element

Calculates a cached likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

AbstractDistributionLikelihood element (exactly one)
Variable element (exactly one)

Example:

<cachedPrior>
  <flatGeoSpatialPrior taxon="foo" inside="true" union="true" cache="true">
    <circle idref="circle10">
    <polygon idref="polygon3">
    <data>
      <duplicatedParameter idref="duplicatedParameter2">
      <differenceParameter idref="differenceParameter6">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter7">
      <complementParameter idref="complementParameter8">
    </data>
  </flatGeoSpatialPrior>
  <markovRandomFieldMatrix asCorrelation="true" dim="1">
    <diagonal>
      <designMatrix idref="designMatrix2">
    </diagonal>
    <offDiagonal>
      <differenceParameter idref="differenceParameter1">
    </offDiagonal>
    <nugget>
      <differenceParameter idref="differenceParameter4">
    </nugget>
  </markovRandomFieldMatrix>
</cachedPrior>

`<cartogramDiffusionModel>` element

Describes a bivariate diffusion process using cartogram distances.

The element takes following attributes:

cartogramFileName (optional) is of type String
xGridSize is of type Integer
yGridSize is of type Integer

The element has the following contents:

Parameter element (exactly one)
Element named <boundingBox>

Containing:
- minX is of type Double
- maxX is of type Double
- minY is of type Double
- maxY is of type Double

Example:

<cartogramDiffusionModel cartogramFileName="foo" xGridSize="1" yGridSize="1">
  <designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
    <differenceParameter idref="differenceParameter3">
    <matrixParameter idref="matrixParameter4">
    <parameter idref="parameter10">
  </designMatrix>
  <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/>
</cartogramDiffusionModel>

`<caseToCaseTransmissionLikelihood>` element

This element represents a probability distribution for epidemiological parameters of an outbreakgiven a phylogenetic tree

The element has the following contents:

CaseToCaseTreeLikelihood element (exactly one)

The tree likelihood
SpatialKernel element (zero or one)

The spatial kernel
Element named <transmissionRate>
The transmission rate
Containing:
- Parameter element (exactly one)
Element named <initialInfectionTimePrior>
The prior probability distibution of the first infection
Containing:
- ParametricDistributionModel element (exactly one)

Example:

<caseToCaseTransmissionLikelihood>
  <withinCaseCoalescent truncate="true">
    <partitionedTreeModel idref="partitionedTreeModel5">
    <maxFirstInfToRoot>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
    </maxFirstInfToRoot>
    <demographicModel>
      <emergingEpidemic idref="emergingEpidemic10">
    </demographicModel>
  </withinCaseCoalescent>
  <transmissionRate>
    <diagonalMatrix idref="diagonalMatrix3">
  </transmissionRate>
</caseToCaseTransmissionLikelihood>

`<cataclysm>` element

A demographic model of exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <growthRate>
The rate of exponential growth before the cataclysmic event.
Containing:
- Parameter element (exactly one)
One of:
- Element named <spikeFactor>
  The factor larger the population size was at its height.
  Containing:
  - Parameter element (exactly one)
- Element named <declineRate>
  
  Containing:
  - Parameter element (exactly one)
Element named <timeOfCataclysm>
The time of the cataclysmic event that lead to exponential decline.
Containing:
- Parameter element (exactly one)

Example:

<cataclysm units="generations">
  <populationSize>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
  </populationSize>
  <growthRate>
    <matrixParameter idref="matrixParameter6">
  </growthRate>
  <declineRate>
    <differenceParameter idref="differenceParameter4">
  </declineRate>
  <timeOfCataclysm>
    <vectorSlice idref="vectorSlice7">
  </timeOfCataclysm>
</cataclysm>

`<categoryOutbreak>` element

Parses a set of ‘category’ farm outbreak and the information that they all share

The element takes following attributes:

hasLatentPeriods is of type String

“Whether to include a latent period in the model”
hasGeography (optional) is of type Boolean

The element has the following contents:

ProductStatistic elements (zero to 2)
Element named <categoryCase>

Containing:
- wasEverInfected is of type Boolean
- hostID is of type String
  
  “The unique identifier for this host”
- endTime (optional) is of type String
  
  “The time of noninfectiousness of this host”
- Taxon elements (zero or more)
- Element named <infectionTimeBranchPosition>
  The exact position on the branch along which the infection of this case occurs that it actually does occur
  Containing:
  - Parameter element (exactly one)
- Element named <spatialCoordinates>
  The spatial coordinates of this case
  Containing:
  - Parameter element (exactly one)
- latentCategory (optional) is of type String
  
  “The category of latent period”
- infectiousCategory (optional) is of type String
  
  “The category of infectious period”
- indexPriorWeight (optional) is of type String
  
  “The weight of this case in the prior probabilty for theindex case”
Taxa element (exactly one)
Element named <infectiousPeriodPrior>
A prior distribution for the length of infectious periods
Containing:
- AbstractPeriodPriorDistribution element (exactly one)
Element named <latentPeriods>
A prior distribution for the length of latent periods
Containing:
- Parameter element (exactly one)
Element named <distanceMatrix>
A matrix of distances between the cases in this outbreak
Containing:
- Parameter element (exactly one)

Example:

<categoryOutbreak hasLatentPeriods="foo" hasGeography="true">
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
    <apsp idref="apsp10">
    <individual idref="individual5">
    <individual idref="individual7">
  </categoryCase>
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo"/>
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
    <apsp idref="apsp9">
    <taxon idref="taxon6">
    <sp idref="sp8">
    <taxon idref="taxon5">
  </categoryCase>
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
    <taxon idref="taxon3">
    <taxon idref="taxon10">
  </categoryCase>
  <taxa>
    <taxa idref="taxa3">
    <taxa idref="taxa8">
  </taxa>
  <infectiousPeriodPrior>
    <oneOverStDevPeriodPriorDistribution idref="oneOverStDevPeriodPriorDistribution4">
  </infectiousPeriodPrior>
  <infectiousPeriodPrior>
    <normalPeriodPriorDistribution idref="normalPeriodPriorDistribution1">
  </infectiousPeriodPrior>
  <infectiousPeriodPrior>
    <knownVarianceNormalPeriodPriorDistribution idref="knownVarianceNormalPeriodPriorDistribution3">
  </infectiousPeriodPrior>
  <infectiousPeriodPrior>
    <individualPrior idref="individualPrior3">
  </infectiousPeriodPrior>
  <latentPeriods>
    <leafTraitParameter idref="leafTraitParameter8">
  </latentPeriods>
  <latentPeriods>
    <copyParameterValues idref="copyParameterValues6">
  </latentPeriods>
</categoryOutbreak>

`<centeredScale>` element

A centered-scale operator. This operator scales the the values of a multi-dimensional parameter so as to perserve the mean. It does this by expanding or conrtacting the parameter values around the mean.

The element takes following attributes:

weight is of type Double
scaleFactor is of type Double
autoOptimize (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<centeredScale weight="1.0" scaleFactor="1.0" autoOptimize="true">
  <differenceMatrixParameter/>
</centeredScale>

`<changeNumHybridizations>` element

Operator which changes the number of tetraploid subtrees (hybridizations) by merging and splitting them.

The element takes following attributes:

weight is of type Double

The element has the following contents:

AlloppSpeciesBindings element (exactly one)
AlloppSpeciesNetworkModel element (exactly one)

Example:

<changeNumHybridizations weight="1.0">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp1">
    <apsp idref="apsp2">
    <apsp idref="apsp7">
    <apsp idref="apsp10">
    <geneTrees>
      <starTreeModel idref="starTreeModel4">
      <starTreeModel idref="starTreeModel5">
      <gtree popfactor="1.0">
        <partitionedTreeModel idref="partitionedTreeModel8">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies4">
    <tipPopulations value="1.0">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </tipPopulations>
    <rootPopulations value="1.0">
      <diagonalMatrix idref="diagonalMatrix7">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</changeNumHybridizations>

`<circle>` element

This element represents a regular circle polygon.

The element takes following attributes:

latitude is of type Double
longitude is of type Double
radius is of type Double
numberOfPoints (optional) is of type Integer

Example:

<circle latitude="1.0" longitude="1.0" radius="1.0" numberOfPoints="1"/>

`<clusterSingleMoveOperator>` element

An operator that moves single elements between clusters.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Parameter element (exactly one)

Example:

<clusterSingleMoveOperator weight="1.0">
  <productParameter>
    <maskedParameter idref="maskedParameter6">
    <matrixMatrixProduct idref="matrixMatrixProduct8">
  </productParameter>
</clusterSingleMoveOperator>

`<clusterSplitMergeOperator>` element

An operator that splits and merges clusters.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Parameter element (exactly one)
Element named <locations>

Containing:
- MatrixParameter element (exactly one)

Example:

<clusterSplitMergeOperator weight="1.0">
  <leafTraitParameter taxon="foo" setBounds="true">
    <treeModel idref="treeModel8">
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter8">
  </leafTraitParameter>
  <locations>
    <dataFromTreeTips idref="dataFromTreeTips1">
  </locations>
</clusterSplitMergeOperator>

`<cNcSPerSiteAnalysis>` element

Performs a trace analysis of N and S counts.

The element takes following attributes:

cutoff (optional) is of type Double
burnin (optional) is of type Integer
includePValues (optional) is of type Boolean
includeSymbol (optional) is of type Boolean
includeClassification (optional) is of type Boolean
simulationOutcome (optional) is of type Boolean
siteSimulation (optional) is of type String
separator (optional) is of type String

Example:

<cNcSPerSiteAnalysis cutoff="1.0" burnin="1" includePValues="true" includeSymbol="true" includeClassification="true" simulationOutcome="true" siteSimulation="foo" separator="foo"/>

`<cNcSTodNdSPerSiteAnalysis>` element

Performs a trace analysis of N and S counts.

The element takes following attributes:

fileNameCN (optional) is of type String
fileNameCS (optional) is of type String
cutoff (optional) is of type Double
proportion (optional) is of type Double
burnin (optional) is of type Integer
sample (optional) is of type Boolean
includeHPD (optional) is of type Boolean
includeSymbol (optional) is of type Boolean
includeLevel (optional) is of type Boolean
includeClassification (optional) is of type Boolean
simulationOutcome (optional) is of type Boolean
siteSimulation (optional) is of type String
test (optional) is of type String
separator (optional) is of type String

Example:

<cNcSTodNdSPerSiteAnalysis fileNameCN="foo" fileNameCS="foo" cutoff="1.0" proportion="1.0" burnin="1" sample="true" includeHPD="true" includeSymbol="true" includeLevel="true" includeClassification="true" simulationOutcome="true" siteSimulation="foo" test="foo" separator="foo"/>

`<coalescentConstantLikelihood>` element

Calculates the number of possible combinations of coalescent events.

The element has the following contents:

TreeModel element (exactly one)

Example:

<coalescentConstantLikelihood>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <starTreeModel idref="starTreeModel2">
    <rootHeight>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix7">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <immutableParameter idref="immutableParameter1">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <maskedParameter idref="maskedParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <fastMatrixParameter idref="fastMatrixParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundParameter idref="compoundParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <dataFromTreeTips idref="dataFromTreeTips10">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak10">
    </outbreak>
  </partitionedTreeModel>
</coalescentConstantLikelihood>

`<coalescentEventsStatistic>` element

The element has the following contents:

CoalescentIntervalProvider element (exactly one)

Example:

<coalescentEventsStatistic>
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <differenceParameter idref="differenceParameter9">
    </populationSizes>
    <precisionParameter>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    </precisionParameter>
    <populationTree>
      <partitionedTreeModel idref="partitionedTreeModel2">
      <partitionedTreeModel idref="partitionedTreeModel2">
    </populationTree>
  </gmrfSkyrideLikelihood>
</coalescentEventsStatistic>

`<coalescentHeightsReferencePrior>` element

Calculates the coalescent height probabilities based on a sample of coalescent heights.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
dimension is of type Integer

The element has the following contents:

Statistic elements (one or more)

Example:

<coalescentHeightsReferencePrior fileName="foo" parameterColumn="foo" dimension="1">
  <externalLengthStatistic name="foo">
    <treeModel idref="treeModel2">
    <taxa idref="taxa3">
  </externalLengthStatistic>
</coalescentHeightsReferencePrior>

`<coalescentIntervalStatistic>` element

The element has the following contents:

CoalescentIntervalProvider element (exactly one)

Example:

<coalescentIntervalStatistic>
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <compoundParameter idref="compoundParameter3">
    </populationSizes>
    <precisionParameter>
      <matrixMatrixProduct idref="matrixMatrixProduct7">
    </precisionParameter>
    <populationTree>
      <starTreeModel idref="starTreeModel3">
      <treeModel idref="treeModel8">
    </populationTree>
  </gmrfSkyrideLikelihood>
</coalescentIntervalStatistic>

`<coalescentLikelihood>` element

This element represents the likelihood of the tree given the demographic function.

The element has the following contents:

Element named <model>
The demographic model which describes the effective population size over time
Containing:
- DemographicModel element (exactly one)
Element named <populationTree>
Tree(s) to compute likelihood for
Containing:
- factor (optional) is of type Double
- TreeModel element (exactly one)
Element named <include>
An optional subset of taxa on which to calculate the likelihood (should be monophyletic)
Containing:
- Taxa element (exactly one)
Element named <exclude>
One or more subsets of taxa which should be excluded from calculate the likelihood (should be monophyletic)
Containing:
- Taxa elements (one or more)

Example:

<coalescentLikelihood>
  <model>
    <logisticGrowth idref="logisticGrowth3">
  </model>
  <populationTree factor="1.0">
    <starTreeModel idref="starTreeModel10">
  </populationTree>
</coalescentLikelihood>

`<coalescentSimulator>` element

This element returns a simulated tree under the given demographic model. The element can be nested to simulate with monophyletic clades. The tree will be rescaled to the given height.

The element takes following attributes:

height (optional) is of type Double

””

The element has the following contents:

Tree elements (zero or more)
TaxonList elements (zero or more)
DemographicModel elements (zero or more)

Example:

<coalescentSimulator height="1.0">
  <tree units="years">
    <node idref="node10">
  </tree>
  <mulSpeciesTree constantRoot="true" constantPopulation="true">
    <mulSpecies idref="mulSpecies5">
    <sppSplitPopulations value="1.0">
      <dataFromTreeTips idref="dataFromTreeTips5">
    </sppSplitPopulations>
  </mulSpeciesTree>
  <upgmaTree usingDates="true" rootHeight="1.0" nonzeroBranchLengths="true">
    <distanceMatrix idref="distanceMatrix3">
  </upgmaTree>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <treeModel idref="treeModel5">
    <rootHeight>
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <fastMatrixParameter idref="fastMatrixParameter10">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <fastMatrixParameter idref="fastMatrixParameter10">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <leafTraitParameter idref="leafTraitParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <duplicatedParameter idref="duplicatedParameter6">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak5">
    </outbreak>
  </partitionedTreeModel>
  <categoryOutbreak hasLatentPeriods="foo" hasGeography="true">
    <productStatistic idref="productStatistic8">
    <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo"/>
    <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
      <sp idref="sp6">
      <taxon idref="taxon1">
      <individual idref="individual8">
    </categoryCase>
    <taxa idref="taxa1">
    <infectiousPeriodPrior>
      <normalPeriodPriorDistribution idref="normalPeriodPriorDistribution7">
    </infectiousPeriodPrior>
    <infectiousPeriodPrior>
      <individualPrior idref="individualPrior6">
    </infectiousPeriodPrior>
    <infectiousPeriodPrior>
      <oneOverStDevPeriodPriorDistribution idref="oneOverStDevPeriodPriorDistribution3">
    </infectiousPeriodPrior>
    <latentPeriods>
      <dataFromTreeTips idref="dataFromTreeTips9">
    </latentPeriods>
    <latentPeriods>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter7">
    </latentPeriods>
    <latentPeriods>
      <parameter idref="parameter7">
    </latentPeriods>
    <latentPeriods>
      <productParameter idref="productParameter10">
    </latentPeriods>
  </categoryOutbreak>
  <attributePatterns attribute="foo" secondary="foo">
    <hiddenNucleotides idref="hiddenNucleotides9">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork2">
  </attributePatterns>
  <exponentialExponential units="substitutions">
    <populationSize>
      <productParameter idref="productParameter3">
    </populationSize>
    <growthRate>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </growthRate>
    <ancestralGrowthRate>
      <differenceParameter idref="differenceParameter1">
    </ancestralGrowthRate>
    <transitionTime>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    </transitionTime>
  </exponentialExponential>
</coalescentSimulator>

`<coalescentTree>` element

This element returns a simulated tree under the given demographic model.

The element takes following attributes:

rescaleHeight (optional) is of type Double

“Attempt to rescale the tree to the given root height”
rootHeight (optional) is of type Double

””

The element has the following contents:

Tree elements (zero or more)
TaxonList elements (zero or more)
Element named <constrainedTaxa>

Containing:
- TaxonList elements (zero or more)
- Element named <tmrca>
  
  Containing:
  - TaxonList elements (zero or more)
DemographicModel element (exactly one)

Example:

<coalescentTree rescaleHeight="1.0" rootHeight="1.0">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <argTreeModel idref="argTreeModel10">
    <rootHeight>
      <sumParameter idref="sumParameter3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice4">
    </nodeHeights>
    <leafHeight taxon="foo">
      <jointParameter idref="jointParameter10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <productParameter idref="productParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <jointParameter idref="jointParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <parameter idref="parameter10">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <diagonalMatrix idref="diagonalMatrix1">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundParameter idref="compoundParameter2">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak9">
    </outbreak>
  </partitionedTreeModel>
  <neighborJoiningTree>
    <distanceMatrix idref="distanceMatrix4">
  </neighborJoiningTree>
  <speciesTree bmPrior="true" constantRoot="true" constantPopulation="true">
    <species idref="species10">
    <sppSplitPopulations value="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter3">
    </sppSplitPopulations>
  </speciesTree>
  <upgmaTree usingDates="true" rootHeight="1.0" nonzeroBranchLengths="true">
    <distanceMatrix idref="distanceMatrix3">
  </upgmaTree>
  <taxa>
    <apsp idref="apsp6">
    <individual idref="individual3">
    <individual idref="individual9">
    <taxon idref="taxon10">
  </taxa>
  <tree units="generations">
    <node idref="node5">
  </tree>
  <cataclysm units="months">
    <populationSize>
      <parameter idref="parameter8">
    </populationSize>
    <growthRate>
      <jointParameter idref="jointParameter2">
    </growthRate>
    <declineRate>
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </declineRate>
    <timeOfCataclysm>
      <leafTraitParameter idref="leafTraitParameter5">
    </timeOfCataclysm>
  </cataclysm>
</coalescentTree>

`<codonPartitionedRobustCounting>` element

A parser to specify robust counting procedures on codon partitioned models

The element takes following attributes:

geneticCode (optional) is of type String

“The genetic code to use”
useUniformization (optional) is of type Boolean
includeExternalBranches (optional) is of type Boolean
includeInternalBranches (optional) is of type Boolean
unconditionedPerBranch (optional) is of type Boolean
averageRates (optional) is of type Boolean
labeling is of type String
saveCompleteHistory (optional) is of type Boolean
useNewNeutralModel (optional) is of type Boolean

The element has the following contents:

Element named <firstPosition>

Containing:
- AncestralStateBeagleTreeLikelihood element (exactly one)
Element named <secondPosition>

Containing:
- AncestralStateBeagleTreeLikelihood element (exactly one)
Element named <thirdPosition>

Containing:
- AncestralStateBeagleTreeLikelihood element (exactly one)
TreeModel element (exactly one)

Example:

<codonPartitionedRobustCounting geneticCode="echinodermMitochondrial" useUniformization="true" includeExternalBranches="true" includeInternalBranches="true" unconditionedPerBranch="true" averageRates="true" labeling="foo" saveCompleteHistory="true" useNewNeutralModel="true">
  <firstPosition>
    ERROR!
  </firstPosition>
  <secondPosition>
    ERROR!
  </secondPosition>
  <thirdPosition>
    ERROR!
  </thirdPosition>
  <starTreeModel>
    <argTreeModel idref="argTreeModel7">
    <rootHeight>
      <compoundParameter idref="compoundParameter8">
    </rootHeight>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter9">
    </leafHeight>
    <leafHeight taxon="foo">
      <vectorSlice idref="vectorSlice10">
    </leafHeight>
    <leafHeight taxon="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix1">
    </leafHeight>
  </starTreeModel>
</codonPartitionedRobustCounting>

`<column>` element

Specifies formating options for one or more columns in a log file.

The element takes following attributes:

label (optional) is of type String

“The label of the column. If this is specified and more than one statistic is in this column, then the label will be appended by the index of the statistic to create individual column names”
sf (optional) is of type Integer
dp (optional) is of type Integer
width (optional) is of type Integer
format (optional) is of type String

The element has the following contents:

Object elements (one or more)

Example:

<column label="foo" sf="1" dp="1" width="1" format="foo">
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <inhibitionLikelihood idref="inhibitionLikelihood7">
  </continuousDiffusionStatistic>
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood7">
    <inhibitionLikelihood idref="inhibitionLikelihood9">
    <inhibitionLikelihood idref="inhibitionLikelihood4">
  </continuousDiffusionStatistic>
</column>

`<compatibilityStatistic>` element

A statistic that returns true if a pair of trees are compatible

The element takes following attributes:

name (optional) is of type String

“A name for this statistic for the purpose of logging”

The element has the following contents:

Tree element (exactly one)
Element named <compatibleWith>

Containing:
- Tree element (exactly one)
Tree element (exactly one)

Example:

<compatibilityStatistic name="foo">
  <speciesTree bmPrior="true" constantRoot="true" constantPopulation="true">
    <species idref="species3">
    <sppSplitPopulations value="1.0">
      <parameter idref="parameter6">
    </sppSplitPopulations>
  </speciesTree>
  <compatibleWith>
    <rescaledTree idref="rescaledTree4">
  </compatibleWith>
  <newick usingDates="true" usingHeights="true" rescaleHeight="1.0" rescaleLength="1.0" units="mutations">
    foo
  </newick>
</compatibilityStatistic>

`<complementParameter>` element

A element-wise complement of parameters.

The element has the following contents:

Parameter element (exactly one)

Example:

<complementParameter>
  <compoundMatrixParameter>
    <designMatrix idref="designMatrix3">
    <matrixParameter idref="matrixParameter4">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
  </compoundMatrixParameter>
</complementParameter>

`<completeHistoryLogger>` element

A logger to record all transitions in the complete history.

The element has the following contents:

MarkovJumpsTraitProvider element (exactly one)
HistoryFilter element (zero or one)

Example:

<completeHistoryLogger>
  ERROR!
</completeHistoryLogger>

`<complexSubstitutionModel>` element

A general irreversible model of sequence substitution for any data type.

The element takes following attributes:

randomizeIndicator (optional) is of type Boolean
bssvsTolerance (optional) is of type Double
bssvsScalar (optional) is of type Double
checkConditioning (optional) is of type Boolean
normalized (optional) is of type Boolean

The element has the following contents:

One of:
- dataType is of type String
  
  “The type of sequence data”
- DataType element (exactly one)
One of:
- Element named <frequencies>
  
  Containing:
  - FrequencyModel element (exactly one)
- Element named <rootFrequencies>
  
  Containing:
  - FrequencyModel element (exactly one)
Element named <rates>

Containing:
- Parameter element (zero or one)
Element named <rateIndicator>

Containing:
- Parameter element (exactly one)

Example:

<complexSubstitutionModel dataType="generalDataType" randomizeIndicator="true" bssvsTolerance="1.0" bssvsScalar="1.0" checkConditioning="true" normalized="true">
  <rootFrequencies>
    <frequencyModel idref="frequencyModel6">
  </rootFrequencies>
  <rates/>
</complexSubstitutionModel>

`<composedTransform>` element

null

The element has the following contents:

Element named <outer>

Containing:
- Transform$ParsedTransform element (exactly one)
Element named <inner>

Containing:
- Transform$ParsedTransform element (exactly one)

Example:

<composedTransform>
  <outer>
    <inverseTransform idref="inverseTransform3">
  </outer>
  <inner>
    <inverseTransform idref="inverseTransform7">
  </inner>
</composedTransform>

`<compositeDataType>` element

Defines a composite DataType consisting of multiple data types

The element has the following contents:

DataType elements (exactly 2)

Example:

<compositeDataType>
  <generalDataType>
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood9">
    <argCoalescentLikelihood idref="argCoalescentLikelihood5">
    <duplicatedParameter idref="duplicatedParameter7">
  </generalDataType>
  <microsatellite/>
</compositeDataType>

`<compoundBranchRateModel>` element

This element provides a strict clock model. All branches have the same rate of molecular evolution.

The element has the following contents:

BranchRateModel elements (one or more)

The component branch rate models

Example:

<compoundBranchRateModel>
  <randomLocalClockModel ratesAreMultipliers="true" threshold="1.0">
    <treeModel idref="treeModel2">
    <rateIndicator>
      <parameter idref="parameter10">
    </rateIndicator>
    <rates>
      <diagonalMatrix idref="diagonalMatrix7">
    </rates>
  </randomLocalClockModel>
  <randomLocalClockModel ratesAreMultipliers="true" threshold="1.0">
    <starTreeModel idref="starTreeModel3">
    <rateIndicator>
      <productParameter idref="productParameter9">
    </rateIndicator>
    <rates>
      <fastMatrixParameter idref="fastMatrixParameter3">
    </rates>
  </randomLocalClockModel>
  <randomLocalClockModel ratesAreMultipliers="true" threshold="1.0">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5">
    <rateIndicator>
      <maskedMatrixParameter idref="maskedMatrixParameter1">
    </rateIndicator>
    <rates>
      <differenceMatrixParameter idref="differenceMatrixParameter1">
    </rates>
  </randomLocalClockModel>
  <attributeBranchRateModel rateAttribute="foo">
    <treeModel idref="treeModel3">
  </attributeBranchRateModel>
</compoundBranchRateModel>

`<compoundFastMatrixParameter>` element

A compound matrix parameter constructed from its component parameters.

The element has the following contents:

MatrixParameterInterface elements (one or more)

Example:

<compoundFastMatrixParameter>
  <approximateFactorAnalysisPrecision>
    <L>
      <designMatrix idref="designMatrix1">
    </L>
    <gamma>
      <matrixMatrixProduct idref="matrixMatrixProduct5">
    </gamma>
  </approximateFactorAnalysisPrecision>
  <elementWiseMatrixMultiplicationParameter/>
</compoundFastMatrixParameter>

`<compoundGaussianProcess>` element

Returned a Gaussian process formed from an ordered list of independent Gaussian processes

The element has the following contents:

GaussianProcessRandomGenerator elements (one or more)

Example:

<compoundGaussianProcess>
  <gaussianProcessFromTree>
    ERROR!
  </gaussianProcessFromTree>
</compoundGaussianProcess>

`<appendedPotentialDerivative>` element

null

The element has the following contents:

GradientWrtParameterProvider elements (one or more)

Example:

<appendedPotentialDerivative>
  <appendedPotentialDerivative>
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood6">
    <sumDerivative idref="sumDerivative4">
    <sumDerivative idref="sumDerivative4">
    <gradient idref="gradient7">
  </appendedPotentialDerivative>
  <sumDerivative>
    <sumDerivative idref="sumDerivative2">
    <gradient idref="gradient8">
    <gradient idref="gradient10">
  </sumDerivative>
  <maskedGradient>
    <appendedPotentialDerivative idref="appendedPotentialDerivative2">
    <mask>
      <differenceMatrixParameter idref="differenceMatrixParameter9">
    </mask>
  </maskedGradient>
  <sumDerivative>
    <appendedPotentialDerivative idref="appendedPotentialDerivative1">
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood3">
    <appendedPotentialDerivative idref="appendedPotentialDerivative10">
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood2">
  </sumDerivative>
</appendedPotentialDerivative>

`<compoundLikelihood>` element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

threads (optional) is of type Integer

The element has the following contents:

Likelihood elements ( or more)

Example:

<compoundLikelihood threads="1">
  <dirichletPrior counts="0.5 1.0" sumsTo="1.0">
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView9">
    <continuousDiffusionStatistic idref="continuousDiffusionStatistic3">
    <logarithmStatistic idref="logarithmStatistic7">
  </dirichletPrior>
  <productOfExponentialsPosteriorMeansLoess fileName="foo" parameterColumn="foo" dimension="1">
    <starTreeModel idref="starTreeModel9">
  </productOfExponentialsPosteriorMeansLoess>
</compoundLikelihood>

`<compoundMatrixParameter>` element

A compound matrix parameter constructed from its component parameters.

The element has the following contents:

MatrixParameter elements (one or more)

Example:

<compoundMatrixParameter>
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <matrixMatrixProduct idref="matrixMatrixProduct8">
    </diagonal>
    <offDiagonal>
      <matrixParameter idref="matrixParameter4">
    </offDiagonal>
  </compoundSymmetricMatrix>
  <matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter1">
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter3">
  </matrixParameter>
</compoundMatrixParameter>

`<compoundParameter>` element

A multidimensional parameter constructed from its component parameters.

The element has the following contents:

Parameter elements (one or more)

Example:

<compoundParameter>
  <buildCompoundSymmetricMatrix/>
</compoundParameter>

`<compoundSymmetricMatrix>` element

A diagonal matrix parameter constructed from its diagonals.

The element takes following attributes:

asCorrelation (optional) is of type Boolean

The element has the following contents:

Element named <diagonal>

Containing:
- Parameter element (exactly one)
Element named <offDiagonal>

Containing:
- Parameter element (exactly one)

Example:

<compoundSymmetricMatrix asCorrelation="true">
  <diagonal>
    <sumParameter idref="sumParameter7">
  </diagonal>
  <offDiagonal>
    <copyParameterValues idref="copyParameterValues7">
  </offDiagonal>
</compoundSymmetricMatrix>

`<compoundTransform>` element

null

The element has the following contents:

Transform$ParsedTransform elements (one or more)
Parameter element (exactly one)

Example:

<compoundTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform10">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform9">
    </inner>
  </composedTransform>
  <transform type="foo" start="1" end="1" every="1" inverseTransform="true">
    <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    <matrixMatrixProduct idref="matrixMatrixProduct8">
  </transform>
  <composedTransform>
    <outer>
      <composedTransform idref="composedTransform9">
    </outer>
    <inner>
      <transform idref="transform6">
    </inner>
  </composedTransform>
  <transform type="foo" start="1" end="1" every="1" inverseTransform="true">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    <dataFromTreeTips idref="dataFromTreeTips4">
    <maskedMatrixParameter idref="maskedMatrixParameter2">
    <maskedMatrixParameter idref="maskedMatrixParameter10">
  </transform>
  <jointParameter>
    <maskedParameter idref="maskedParameter6">
  </jointParameter>
</compoundTransform>

`<conditionalCladeProbability>` element

Calculates the conditional clade probability of a tree based on a sample of tree space.

The element takes following attributes:

fileName is of type String
burnin is of type Integer
epsilon is of type Double

The element has the following contents:

TreeModel element (exactly one)

Example:

<conditionalCladeProbability fileName="foo" burnin="1" epsilon="1.0">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <speciesTree idref="speciesTree3">
    <rootHeight>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter6">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    </nodeHeights>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <complementParameter idref="complementParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <vectorSlice idref="vectorSlice9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <jointParameter idref="jointParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <productParameter idref="productParameter8">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter4">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak8">
    </outbreak>
  </partitionedTreeModel>
</conditionalCladeProbability>

`<ConditionalCladeProbabilityAnalysis>` element

Calculates posterior of a tree on a trace consisting of trees.

The element takes following attributes:

fileName is of type String

“name of a tree log file”
burnIn (optional) is of type Integer

“The number of trees discarded because of the burn-in period.”
minCladeProbability (optional) is of type Double

“The frequency in % that a clade must achieve to be considered for the evaulation. Otherwise it’s set to epsilon.”
epsilon (optional) is of type Double

“Epsilon is the default number of occurences for a clade if a clade wasn’t observed. The default is 1.0”
referenceTree is of type String

“File in newick format containing a tree which is evaluated with the statistic.”

Example:

<ConditionalCladeProbabilityAnalysis fileName="trees.log" burnIn="1" minCladeProbability="1.0" epsilon="1.0" referenceTree="foo"/>

`<constantDecreasedVariancePrior>` element

Calculates a product of exponentials based on a set of posterior sample means.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
dimension is of type Integer

The element has the following contents:

TreeModel element (exactly one)

Example:

<constantDecreasedVariancePrior fileName="foo" parameterColumn="foo" dimension="1">
  <treeModel fixHeights="true" fixTree="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
    <rootHeight>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <complementParameter idref="complementParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <leafTraitParameter idref="leafTraitParameter7">
    </nodeHeights>
    <leafHeight taxon="foo">
      <differenceParameter idref="differenceParameter10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter5">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundParameter idref="compoundParameter5">
    </nodeRates>
  </treeModel>
</constantDecreasedVariancePrior>

`<constantExponential>` element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <growthPhaseStartTime>

Containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate>
  A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
  Containing:
  - Parameter element (exactly one)
- Element named <doublingTime>
  This parameter determines the doubling time.
  Containing:
  - Parameter element (exactly one)

Example:

<constantExponential units="generations">
  <populationSize>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision7">
  </populationSize>
  <growthPhaseStartTime>
    <differenceMatrixParameter idref="differenceMatrixParameter3">
  </growthPhaseStartTime>
  <doublingTime>
    <dataFromTreeTips idref="dataFromTreeTips10">
  </doublingTime>
</constantExponential>

`<constantLikelihood>` element

A function that returns a constant value as a likelihood.

The element takes following attributes:

logValue is of type Double

Example:

<constantLikelihood logValue="1.0"/>

`<constantLogistic>` element

A demographic model of constant population size followed by logistic growth.

The element takes following attributes:

units is of type String

“the units”
alpha is of type Double

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <ancestralPopulationSize>

Containing:
- Parameter element (exactly one)
Element named <growthRate>

Containing:
- Parameter element (exactly one)
Element named <shape>

Containing:
- Parameter element (exactly one)

Example:

<constantLogistic units="generations" alpha="1.0">
  <populationSize>
    <complementParameter idref="complementParameter5">
  </populationSize>
  <ancestralPopulationSize>
    <diagonalMatrix idref="diagonalMatrix3">
  </ancestralPopulationSize>
  <growthRate>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter5">
  </growthRate>
  <shape>
    <designMatrix idref="designMatrix8">
  </shape>
</constantLogistic>

`<constantPatterns>` element

Creates a set of patterns for constant sites with weights as provided.

The element has the following contents:

PatternList element (exactly one)
Element named <counts>

Containing:
- Parameter element (exactly one)

Example:

<constantPatterns>
  <microsatelliteSimulator>
    <microsatellite idref="microsatellite2">
    <taxa idref="taxa4">
    <treeModel idref="treeModel7">
    ERROR!
  </microsatelliteSimulator>
  <counts>
    <compoundParameter idref="compoundParameter10">
  </counts>
</constantPatterns>

`<constantSize>` element

A demographic model representing a constant population size through time.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)

Example:

<constantSize units="months">
  <populationSize>
    <matrixMatrixProduct idref="matrixMatrixProduct3">
  </populationSize>
</constantSize>

`<constantTreeTopologyPrior>` element

Calculates the constant tree topology prior, i.e. 1 over the total number of rooted bifurcating trees.

The element has the following contents:

TreeModel element (exactly one)

Example:

<constantTreeTopologyPrior>
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork7">
    <rootHeight>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <parameter idref="parameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundParameter idref="compoundParameter5">
    </nodeTraits>
    <leafTrait taxon="foo" name="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter10">
    </leafTrait>
  </treeModel>
</constantTreeTopologyPrior>

`<constExpConst>` element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

units is of type String

“the units”
useNumericalIntegration (optional) is of type Boolean

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
One of:
- Element named <ancestralPopulationSize>
  
  Containing:
  - Parameter element (exactly one)
- Element named <growthRate>
  
  Containing:
  - Parameter element (exactly one)
Element named <finalPhaseStartTime>

Containing:
- Parameter element (exactly one)
Element named <growthPhaseTime>

Containing:
- Parameter element (exactly one)

Example:

<constExpConst units="days" useNumericalIntegration="true">
  <populationSize>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix4">
  </populationSize>
  <ancestralPopulationSize>
    <jointParameter idref="jointParameter6">
  </ancestralPopulationSize>
  <finalPhaseStartTime>
    <immutableParameter idref="immutableParameter4">
  </finalPhaseStartTime>
  <growthPhaseTime>
    <mvPolyaLikelihood idref="mvPolyaLikelihood9">
  </growthPhaseTime>
</constExpConst>

`<contemporaneousCoalescentConstantLikelihood>` element

Calculates the number of possible combinations of coalescent events.

The element has the following contents:

TreeModel element (exactly one)

Example:

<contemporaneousCoalescentConstantLikelihood>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <sequenceSimulator idref="sequenceSimulator10">
  </empiricalTreeDistributionModel>
</contemporaneousCoalescentConstantLikelihood>

`<continuousBranchRates>` element

This element returns a continuous quantile uncorrelated relaxed clock model.

The element takes following attributes:

singleRootRate (optional) is of type Boolean

“Whether only a single rate should be used for the two children branches of the root”
normalize (optional) is of type Boolean

“Whether the mean rate has to be normalized to a particular value”
normalizeBranchRateTo (optional) is of type Double

“The mean rate to normalize to, if normalizing”

The element has the following contents:

TreeModel element (exactly one)
Element named <distribution>
The distribution model for rates among branches
Containing:
- ParametricDistributionModel element (exactly one)
One of:
- Element named <rateQuantiles>
  The quantiles for each branch
  Containing:
  - Parameter element (exactly one)
- Element named <rateCategoryQuantiles>
  The quantiles for each branch
  Containing:
  - Parameter element (exactly one)

Example:

<continuousBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0">
  <treeModel fixHeights="true" fixTree="true">
    <newick idref="newick5">
    <rootHeight>
      <compoundParameter idref="compoundParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <differenceMatrixParameter idref="differenceMatrixParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter7">
    </nodeHeights>
    <leafHeight taxon="foo">
      <designMatrix idref="designMatrix2">
    </leafHeight>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixParameter idref="matrixParameter6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser10">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixMatrixProduct idref="matrixMatrixProduct5">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <sumParameter idref="sumParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter9">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter8">
    </leafTrait>
  </treeModel>
  <distribution>
    <uniformDistributionModel idref="uniformDistributionModel1">
  </distribution>
  <rateQuantiles>
    <dataFromTreeTips idref="dataFromTreeTips2">
  </rateQuantiles>
</continuousBranchRates>

`<continuousDiffusionStatistic>` element

A statistic that returns the average of the branch diffusion rates

The element takes following attributes:

name (optional) is of type String
greatCircleDistance (optional) is of type Boolean
mode (optional) is of type String
statistic (optional) is of type String
discreteState (optional) is of type String
heightUpper (optional) is of type Double
heightLower (optional) is of type Double
heightLowerSerie (optional) is of type String
dimension (optional) is of type Double
cumulative (optional) is of type Boolean
noise (optional) is of type Boolean
branchSet (optional) is of type String

The element has the following contents:

TaxonList element (zero or one)
AbstractMultivariateTraitLikelihood elements (one or more)
MarkovJumpsBeagleTreeLikelihood element (zero or one)

Example:

<continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <dataFromTreeTips idref="dataFromTreeTips3">
    </traitParameter>
    <bifractionalDiffusionModel idref="bifractionalDiffusionModel7">
    <starTreeModel idref="starTreeModel4">
  </multivariateTraitLikelihood>
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <compoundMatrixParameter idref="compoundMatrixParameter3">
    </traitParameter>
    <mixtureCartogramDiffusionModel idref="mixtureCartogramDiffusionModel8">
    <starTreeModel idref="starTreeModel1">
    ERROR!
  </multivariateTraitLikelihood>
  <inhibitionLikelihood>
    <treeModel idref="treeModel2">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix10">
    <precision>
      <differenceMatrixParameter idref="differenceMatrixParameter5">
    </precision>
  </inhibitionLikelihood>
</continuousDiffusionStatistic>

`<continuousTraitRateModel>` element

This element returns an trait rate model.The branch rates are an average of the rates provided by a node trait.

The element takes following attributes:

dimension (optional) is of type Integer

“The dimension that supplies the rate”

The element has the following contents:

Element named <rate>
The rate parameter
Containing:
- Parameter element (exactly one)
Element named <ratio>
The ratio parameter
Containing:
- Parameter element (exactly one)
SampledMultivariateTraitLikelihood element (zero or one)

Example:

<continuousTraitRateModel dimension="1"/>

`<convert>` element

Converts an alignment to the given data type.

The element takes following attributes:

dataType is of type String

“The type of sequence data”

The element has the following contents:

Alignment element (exactly one)

Example:

<convert dataType="hiddenCodon3">
  <alignment dataType="codon-ascidianMitochondrial">
    <sequence idref="sequence2">
    <sequence idref="sequence5">
    <sequence idref="sequence2">
  </alignment>
</convert>

`<coordinates>` element

This element represents a set of (X,Y,Z) coordinates in KML format

The element has the following contents:

String element (exactly one)

Example:

<coordinates>
  foo
</coordinates>

`<copyParameterValues>` element

Copy parameter values from source to destination

The element has the following contents:

Element named <source>

Containing:
- Parameter element (exactly one)
Element named <destination>

Containing:
- Parameter element (exactly one)

Example:

<copyParameterValues>
  <source>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix4">
  </source>
  <destination>
    <complementParameter idref="complementParameter2">
  </destination>
</copyParameterValues>

`<correlation>` element

This element returns a precision that is the element-wise reciprocal of the child precision.

The element takes following attributes:

dimension1 is of type Integer
dimension2 is of type Integer

The element has the following contents:

MatrixParameter element (exactly one)

Example:

<correlation dimension1="1" dimension2="1">
  <designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
  </designMatrix>
</correlation>

`<countableMixtureBranchRates>` element

This element provides a clock consisting of a mixture of fixed effects and random effects.

The element takes following attributes:

inLogSpace (optional) is of type Boolean
randomize (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)
One of:
- Element named <rates>
  The molecular evolutionary rate parameter
  Containing:
  - Parameter element (exactly one)
- Element named <fixedEffects>
  Fixed effects
  Containing:
  - AbstractBranchRateModel elements (zero or more)
Element named <rateCategories>
Allocation parameter
Containing:
- Parameter element (exactly one)
Element named <randomEffects>
Possible random effects
Containing:
- AbstractBranchRateModel elements (zero or more)
Element named <clade>

Containing:
- category is of type Integer
- includeStem (optional) is of type Boolean
  
  “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
- excludeClade (optional) is of type Boolean
  
  “determines whether to exclude actual branches of the clade from the siteModel (default false).”
- Taxa element (exactly one)
  
  A set of taxa which defines a clade to apply a different site model to

Example:

<countableMixtureBranchRates inLogSpace="true" randomize="true">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <argTreeModel idref="argTreeModel8">
    <rootHeight>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <parameter idref="parameter8">
    </nodeHeights>
    <leafHeight taxon="foo">
      <parameter idref="parameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixMatrixProduct idref="matrixMatrixProduct2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter10">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceParameter idref="differenceParameter5">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundMatrixParameter idref="compoundMatrixParameter7">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak1">
    </outbreak>
  </partitionedTreeModel>
  <rates>
    <copyParameterValues idref="copyParameterValues6">
  </rates>
  <rateCategories>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser6">
  </rateCategories>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa2">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa3">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa2">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa9">
  </clade>
</countableMixtureBranchRates>

`<CSVexport>` element

Write tabular data as an CSV file.

The element takes following attributes:

fileName is of type String

“The name of a BEAST log file (can not include trees, which should be logged separately”
separator (optional) is of type String

“Values separator (default is tab)”

The element has the following contents:

Element named <columns>
A subset of columns from one source
Containing:
- all (optional) is of type Boolean
“Dump all columns. default is TRUE when no columns are specified, FALSE otherwise”
- rows (optional) is of type Boolean
“Write data in rows (default is columns)”
- TabularData element (exactly one)
- Element named <CSVcolumn>
column name
Containing: * <code>name</code> is of type [String;](#string;)
- Parameter element (exactly one)

Example:

<CSVexport fileName="foo" separator="foo">
  <columns all="true" rows="true">
    <logFileTrace idref="logFileTrace4">
  </columns>
</CSVexport>

`<ctmcScalePrior>` element

This element represents the prior for CTMC scale parameter.

The element takes following attributes:

reciprocal (optional) is of type Boolean
trial (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)
Element named <ctmcScale>

Containing:
- Parameter element (exactly one)
SubstitutionModel element (zero or one)

Example:

<ctmcScalePrior reciprocal="true" trial="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <microsatelliteSimulator idref="microsatelliteSimulator3">
  </empiricalTreeDistributionModel>
  <ctmcScale>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
  </ctmcScale>
</ctmcScalePrior>

`<dataFromTreeTips>` element

Takes the data from the tips of a tree and puts it into a MatrixParameter

The element takes following attributes:

traitName is of type String

The element has the following contents:

MultivariateTraitTree element (exactly one)
Element named <traitParameter>

Containing:
- Parameter element (exactly one)
Element named <missingIndicator>

Containing:
- Parameter element (exactly one)

Example:

<dataFromTreeTips traitName="foo">
  <transformedTreeModel version="foo">
    <partitionedTreeModel idref="partitionedTreeModel2">
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser6">
  </transformedTreeModel>
  <traitParameter>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
  </traitParameter>
</dataFromTreeTips>

`<dataLikelihood>` element

null

The element has the following contents:

MarkovJumpsTraitProvider element (exactly one)

Example:

<dataLikelihood>
  ERROR!
</dataLikelihood>

`<date>` element

Specifies a date on a given timescale

The element takes following attributes:

value is of type String

“The value of this date”
origin (optional) is of type String

“The origin of this time scale, which must be a valid calendar date”
units (optional) is of type String

“The units of the timescale”
direction (optional) is of type String

“The direction of the timescale”
precision (optional) is of type Double

“The precision to which the date is specified”

Example:

<!-- a date representing 10 years in the past                                 -->
<date value="10.0" units="years" direction="backwards"/>

<!-- a date representing 300 days after Jan 1st 1989                          -->
<date value="300.0" origin="01/01/89" units="days" direction="forwards"/>

`<deltaExchange>` element

This element returns a delta exchange operator on a given parameter.

The element takes following attributes:

delta is of type Double
parameterWeights (optional) is of type Integer;
weight is of type Double
autoOptimize (optional) is of type Boolean
integer (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<deltaExchange delta="1.0" parameterWeights="1 2 4 8" weight="1.0" autoOptimize="true" integer="true">
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <leafTraitParameter idref="leafTraitParameter8">
    </diagonal>
    <offDiagonal>
      <immutableParameter idref="immutableParameter5">
    </offDiagonal>
  </compoundSymmetricMatrix>
</deltaExchange>

`<deltaMixOperator>` element

This element returns a scale operator on a given parameter.

The element takes following attributes:

delta is of type Double
parameterWeights (optional) is of type Integer;
weight is of type Double
autoOptimize (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<deltaMixOperator delta="1.0" parameterWeights="1 2 4 8" weight="1.0" autoOptimize="true">
  <differenceMatrixParameter/>
</deltaMixOperator>

`<designMatrix>` element

A matrix parameter constructed from its component parameters.

The element takes following attributes:

addIntercept (optional) is of type Boolean
checkIdentifiability (optional) is of type Boolean
form (optional) is of type String
colDimension (optional) is of type Integer
rowDimension (optional) is of type Integer
standardize (optional) is of type Boolean

The element has the following contents:

Parameter elements (zero or more)

Example:

<designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <designMatrix idref="designMatrix9">
    <extendedDataType idref="extendedDataType3">
  </originDestinationDesignMatrix>
</designMatrix>

`<diagonalContrainedMatrixView>` element

A diagonal matrix parameter constructed from its diagonals.

The element takes following attributes:

constraintValue (optional) is of type Double

The element has the following contents:

MatrixParameterInterface element (exactly one)
Element named <mask>

Containing:
- Parameter element (exactly one)

Example:

<diagonalContrainedMatrixView constraintValue="1.0">
  <dataFromTreeTips traitName="foo">
    <starTreeModel idref="starTreeModel4">
    <traitParameter>
      <dataFromTreeTips idref="dataFromTreeTips7">
    </traitParameter>
  </dataFromTreeTips>
  <mask>
    <maskedMatrixParameter idref="maskedMatrixParameter7">
  </mask>
</diagonalContrainedMatrixView>

`<diagonalMatrix>` element

A diagonal matrix parameter constructed from its diagonals.

The element has the following contents:

Parameter element (exactly one)

Example:

<diagonalMatrix>
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter10">
    </diagonal>
    <offDiagonal>
      <maskedParameter idref="maskedParameter8">
    </offDiagonal>
  </compoundSymmetricMatrix>
</diagonalMatrix>

`<differenceStatistic>` element

This element returns a statistic that is the difference of the 2 child statistics.

The element takes following attributes:

absolute (optional) is of type Boolean

The element has the following contents:

Statistic elements (exactly 2)

The two operand statistics

Example:

<differenceStatistic absolute="true">
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <fastMatrixParameter idref="fastMatrixParameter8">
    </diagonal>
    <offDiagonal>
      <complementParameter idref="complementParameter4">
    </offDiagonal>
  </compoundSymmetricMatrix>
  <maskedParameter complement="true" build="true" from="1" to="1" every="1">
    <complementParameter idref="complementParameter8">
  </maskedParameter>
</differenceStatistic>

`<differenceMatrixParameter>` element

differenceMatrixParameter

Example:

<differenceMatrixParameter/>

`<differenceParameter>` element

A element-wise difference of parameters.

The element has the following contents:

Parameter elements (one or more)

Example:

<differenceParameter>
  <complementParameter>
    <vectorSlice idref="vectorSlice2">
  </complementParameter>
  <fastMatrixParameter rows="1" columns="1">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    <dataFromTreeTips idref="dataFromTreeTips2">
    <matrixVectorProductParameter idref="matrixVectorProductParameter6">
    <productParameter idref="productParameter8">
  </fastMatrixParameter>
  <immutableParameter>
    <exponentialStatistic idref="exponentialStatistic3">
  </immutableParameter>
  <blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true"/>
</differenceParameter>

`<differenceStatistic>` element

This element returns a statistic that is the difference of the 2 child statistics.

The element takes following attributes:

absolute (optional) is of type Boolean

The element has the following contents:

Statistic elements (exactly 2)

The two operand statistics

Example:

<differenceStatistic absolute="true">
  <generalizedSkylinePopSizeStatistic/>
  <differenceParameter>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    <duplicatedParameter idref="duplicatedParameter5">
    <vectorSlice idref="vectorSlice6">
  </differenceParameter>
</differenceStatistic>

`<diffusionRateCovarianceStatistic>` element

A statistic that returns the average of the branch rates

The element takes following attributes:

name (optional) is of type String
greatCircleDistance (optional) is of type Boolean
diffusionCoefficient (optional) is of type Boolean

The element has the following contents:

MultivariateTraitTree element (exactly one)
AbstractMultivariateTraitLikelihood elements (one or more)

Example:

<diffusionRateCovarianceStatistic name="foo" greatCircleDistance="true" diffusionCoefficient="true">
  <transformedTreeModel version="foo">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4">
    <designMatrix idref="designMatrix5">
  </transformedTreeModel>
  <inhibitionLikelihood>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
    <compoundMatrixParameter idref="compoundMatrixParameter2">
    <precision>
      <vectorSlice idref="vectorSlice5">
    </precision>
  </inhibitionLikelihood>
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </traitParameter>
    <bifractionalDiffusionModel idref="bifractionalDiffusionModel3">
    <transformedTreeModel idref="transformedTreeModel3">
    ERROR!
  </multivariateTraitLikelihood>
  <inhibitionLikelihood>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    <precision>
      <dataFromTreeTips idref="dataFromTreeTips5">
    </precision>
  </inhibitionLikelihood>
</diffusionRateCovarianceStatistic>

`<continuousDiffusionStatistic>` element

A statistic that returns the average of the branch diffusion rates

The element takes following attributes:

name (optional) is of type String
greatCircleDistance (optional) is of type Boolean
mode (optional) is of type String
statistic (optional) is of type String
discreteState (optional) is of type String
heightUpper (optional) is of type Double
heightLower (optional) is of type Double
heightLowerSerie (optional) is of type String
dimension (optional) is of type Double
cumulative (optional) is of type Boolean
noise (optional) is of type Boolean
branchSet (optional) is of type String

The element has the following contents:

TaxonList element (zero or one)
AbstractMultivariateTraitLikelihood elements (one or more)
MarkovJumpsBeagleTreeLikelihood element (zero or one)

Example:

<continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
  <inhibitionLikelihood>
    <partitionedTreeModel idref="partitionedTreeModel9">
    <designMatrix idref="designMatrix6">
    <precision>
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </precision>
  </inhibitionLikelihood>
  <inhibitionLikelihood>
    <partitionedTreeModel idref="partitionedTreeModel4">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix6">
    <precision>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter5">
    </precision>
  </inhibitionLikelihood>
</continuousDiffusionStatistic>

`<dirichletParameterPrior>` element

Calculates the likelihood of some data under a Dirichlet distribution.

The element takes following attributes:

sumToNumberOfElements (optional) is of type Boolean

The element has the following contents:

Element named <countsParameter>

Containing:
- Parameter element (exactly one)
Element named <data>

Containing:
- Parameter element (exactly one)

Example:

<dirichletParameterPrior sumToNumberOfElements="true">
  <countsParameter>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
  </countsParameter>
  <data>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter6">
  </data>
  <data>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix4">
  </data>
</dirichletParameterPrior>

`<dirichletPrior>` element

Calculates the prior probability of some data under a Dirichlet distribution.

The element takes following attributes:

sumsTo (optional) is of type Double

The element has the following contents:

One of:
- alpha is of type Double;
- counts is of type Double;
Statistic elements (one or more)

Example:

<dirichletPrior counts="0.5 1.0" sumsTo="1.0">
  <parsimonyStatistic name="foo">
    <treeModel idref="treeModel9">
    <state>
      <taxa idref="taxa4">
    </state>
  </parsimonyStatistic>
  <transmissionStatistic name="foo">
    <hostTree>
      <tree idref="tree2">
    </hostTree>
    <parasiteTree>
      <newick idref="newick1">
    </parasiteTree>
  </transmissionStatistic>
  <notBooleanStatistic>
    <test idref="test2">
  </notBooleanStatistic>
  <logarithmStatistic base="1.0">
    <popGraph idref="popGraph3">
  </logarithmStatistic>
</dirichletPrior>

`<dirichletProcessLikelihood>` element

Calculates the likelihood of some items distributed into a number of classes under a Dirichlet drocess.

The element has the following contents:

Element named <eta>
Counts of N items distributed amongst K classes
Containing:
- Statistic element (exactly one)
Element named <chi>
Aggregation parameter
Containing:
- Parameter element (exactly one)

Example:

<dirichletProcessLikelihood>
  <eta>
    <driftedLocationsStatistic idref="driftedLocationsStatistic5">
  </eta>
  <chi>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter4">
  </chi>
</dirichletProcessLikelihood>

`<dirichletProcessOperator>` element

An operator that picks a new allocation of an item to a cluster under the Dirichlet process.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Element named <chi>

Containing:
- Parameter element (exactly one)
Element named <likelihood>

Containing:
- Likelihood element (exactly one)
Parameter element (exactly one)

Example:

<dirichletProcessOperator weight="1.0">
  <chi>
    <compoundMatrixParameter idref="compoundMatrixParameter3">
  </chi>
  <compoundFastMatrixParameter>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision2">
    <mvPolyaLikelihood idref="mvPolyaLikelihood7">
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
  </compoundFastMatrixParameter>
</dirichletProcessOperator>

`<dirtyLikelihood>` element

This element returns a operator that forces the entire model likelihood recomputation

The element takes following attributes:

weight is of type Double

The element has the following contents:

Likelihood element (exactly one)

Example:

<dirtyLikelihood weight="1.0">
  <productOfGammas fileName="foo" parameterColumn="foo" dimension="1" popSize="1.0">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
  </productOfGammas>
</dirtyLikelihood>

`<discreteTraitRateModel>` element

This Branch Rate Model takes a discrete trait reconstruction (provided by a TreeTraitProvider) and gives the rate for each branch of the tree based on the child trait of that branch. The rates for each trait value are specified in a multidimensional parameter.

The element takes following attributes:

traitIndex (optional) is of type Integer
traitName (optional) is of type String

The element has the following contents:

TreeModel element (exactly one)

The tree model
One of:
- All of:
  - TreeTraitProvider element (exactly one)
    
    The trait provider
  - One of:
    - dataType is of type String
      
      “The type of general data”
    - DataType element (exactly one)
- PatternList element (exactly one)
One of:
- All of:
  - Element named <rate>
    The over-all rate
    Containing:
    
    Parameter element (exactly one)
  - Element named <relativeRates>
    The state-specific relative rates
    Containing:
    
    Parameter element (exactly one)
- Element named <rates>
  The state-specific rates
  Containing:
  - Parameter element (exactly one)

Example:

<discreteTraitRateModel traitIndex="1" traitName="foo">
  <starTreeModel>
    <neighborJoiningTree idref="neighborJoiningTree7">
    <rootHeight>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </rootHeight>
    <leafHeight taxon="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    </leafTrait>
  </starTreeModel>
  <maskedPatterns negative="true">
    <convert idref="convert9">
    <mask>
      foo
    </mask>
  </maskedPatterns>
  <rates>
    <jointParameter idref="jointParameter1">
  </rates>
</discreteTraitRateModel>

`<discreteUniformPrior>` element

Calculates the prior probability of some data under a given discrete uniform distribution.

The element takes following attributes:

lower is of type Double
upper is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<discreteUniformPrior lower="1.0" upper="1.0">
  <argReassortmentNodeCount name="foo">
    <argTreeModel idref="argTreeModel4">
  </argReassortmentNodeCount>
  <logarithmStatistic base="1.0">
    <compoundParameter idref="compoundParameter5">
  </logarithmStatistic>
</discreteUniformPrior>

`<discretizedBranchRates>` element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.

The element takes following attributes:

singleRootRate (optional) is of type Boolean

“Whether only a single rate should be used for the two children branches of the root”
overSampling (optional) is of type Integer

“The integer factor for oversampling the distribution model (1 means no oversampling)”
normalize (optional) is of type Boolean

“Whether the mean rate has to be normalized to a particular value”
normalizeBranchRateTo (optional) is of type Double

“The mean rate to normalize to, if normalizing”
randomizeRates (optional) is of type Boolean

“Randomize initial categories”
keepRates (optional) is of type Boolean

“Keep current rate category specification”
cachedRates (optional) is of type Boolean

“Cache rates between steps (default off)”

The element has the following contents:

TreeModel element (exactly one)
Element named <distribution>
The distribution model for rates among branches
Containing:
- ParametricDistributionModel element (exactly one)
Element named <rateCategories>
The rate categories parameter
Containing:
- Parameter element (exactly one)

Example:

<discretizedBranchRates singleRootRate="true" overSampling="1" normalize="true" normalizeBranchRateTo="1.0" randomizeRates="true" keepRates="true" cachedRates="true">
  <starTreeModel>
    <transformedTreeModel idref="transformedTreeModel10">
    <sharedRootHeight>
      <treeModel idref="treeModel1">
    </sharedRootHeight>
    <leafHeight taxon="foo">
      <copyParameterValues idref="copyParameterValues8">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <copyParameterValues idref="copyParameterValues7">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter5">
    </leafTrait>
  </starTreeModel>
  <distribution>
    <inverseGammaDistributionModel idref="inverseGammaDistributionModel7">
  </distribution>
  <rateCategories>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix8">
  </rateCategories>
</discretizedBranchRates>

`<discretizedLocationOperator>` element

This element returns a multivariate Gibbs operator on traits for possible all nodes.

The element takes following attributes:

weight is of type Double
autoOptimize (optional) is of type Boolean
onlyInternalNodes (optional) is of type Boolean
neighborhoodSize (optional) is of type Integer
randomize (optional) is of type Boolean

The element has the following contents:

AbstractMultivariateTraitLikelihood element (exactly one)

Example:

<discretizedLocationOperator weight="1.0" autoOptimize="true" onlyInternalNodes="true" neighborhoodSize="1" randomize="true">
  <inhibitionLikelihood>
    <starTreeModel idref="starTreeModel7">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix2">
    <precision>
      <fastMatrixParameter idref="fastMatrixParameter3">
    </precision>
  </inhibitionLikelihood>
</discretizedLocationOperator>

`<distanceDependentCRPGibbsOperator>` element

An operator that picks a new allocation of an item to a cluster under the Dirichlet process.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Element named <chi>

Containing:
- Parameter element (exactly one)
Element named <likelihood>

Containing:
- Likelihood element (exactly one)
Element named <assignments>

Containing:
- Parameter element (exactly one)
Element named <links>

Containing:
- Parameter element (exactly one)

Example:

<distanceDependentCRPGibbsOperator weight="1.0">
  <chi>
    <fastMatrixParameter idref="fastMatrixParameter8">
  </chi>
  <assignments>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
  </assignments>
  <links>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
  </links>
</distanceDependentCRPGibbsOperator>

`<distanceMatrix>` element

Constructs a distance matrix from a pattern list or alignment

The element takes following attributes:

correction is of type String

“The type of distance correction used”

The element has the following contents:

PatternList element (exactly one)

Example:

<distanceMatrix correction="JC">
  <patterns from="1" to="1" every="1" strip="true" unique="true">
    <convert idref="convert6">
  </patterns>
</distanceMatrix>

`<distributionLikelihood>` element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

Element named <distribution>

Containing:
- ParametricDistributionModel element (exactly one)
Element named <data>

Containing:
- from (optional) is of type Integer
- to (optional) is of type Integer
- Statistic elements (one or more)

Example:

<distributionLikelihood>
  <distribution>
    <exponentialDistributionModel idref="exponentialDistributionModel2">
  </distribution>
  <data from="1" to="1">
    <jointParameter idref="jointParameter6">
  </data>
</distributionLikelihood>

`<dNdSLogger>` element

null

The element takes following attributes:

smooth (optional) is of type Boolean
counts (optional) is of type Boolean
synonymous (optional) is of type Boolean
dn-ds (optional) is of type Boolean

The element has the following contents:

CodonPartitionedRobustCounting elements (exactly 2)
Tree element (exactly one)

Example:

<dNdSLogger smooth="true" counts="true" synonymous="true" dn-ds="true">
  <codonPartitionedRobustCounting geneticCode="alternativeYeast" useUniformization="true" includeExternalBranches="true" includeInternalBranches="true" unconditionedPerBranch="true" averageRates="true" labeling="foo" saveCompleteHistory="true" useNewNeutralModel="true">
    <firstPosition>
      ERROR!
    </firstPosition>
    <secondPosition>
      ERROR!
    </secondPosition>
    <thirdPosition>
      ERROR!
    </thirdPosition>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
  </codonPartitionedRobustCounting>
  <codonPartitionedRobustCounting geneticCode="universal" useUniformization="true" includeExternalBranches="true" includeInternalBranches="true" unconditionedPerBranch="true" averageRates="true" labeling="foo" saveCompleteHistory="true" useNewNeutralModel="true">
    <firstPosition>
      ERROR!
    </firstPosition>
    <secondPosition>
      ERROR!
    </secondPosition>
    <thirdPosition>
      ERROR!
    </thirdPosition>
    <partitionedTreeModel idref="partitionedTreeModel7">
  </codonPartitionedRobustCounting>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <tree idref="tree2">
  </empiricalTreeDistributionModel>
</dNdSLogger>

`<dNdSPerSiteAnalysis>` element

Performs a trace dN/dS analysis.

The element takes following attributes:

cutoff (optional) is of type Double
proportion (optional) is of type Double
burnin (optional) is of type Integer
includeHPD (optional) is of type Boolean
includeCPD (optional) is of type Boolean
includeSymbol (optional) is of type Boolean
includeLevel (optional) is of type Boolean
includeClassification (optional) is of type Boolean
simulationOutcome (optional) is of type Boolean
siteSimulation (optional) is of type String
test (optional) is of type String
separator (optional) is of type String
fileName is of type String

“The traceName of a BEAST log file (can not include trees, which should be logged separately”

Example:

<dNdSPerSiteAnalysis cutoff="1.0" proportion="1.0" burnin="1" includeHPD="true" includeCPD="true" includeSymbol="true" includeLevel="true" includeClassification="true" simulationOutcome="true" siteSimulation="foo" test="foo" separator="foo" fileName="foo"/>

`<double>` element

returns a Double. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as a Double.

The element has the following contents:

One of:
- prompt is of type String
  
  “A message displayed to the user when entering a value for this double”
- Double element (exactly one)

Example:

<double prompt="Enter the length of a piece of string (in metres):"/>

`<driftedLocationsStatistic>` element

This element returns a statistic that shifts a matrix of locations by location drift in the first dimension.

The element has the following contents:

Element named <locations>

Containing:
- MatrixParameter element (exactly one)
Element named <offsets>

Containing:
- Parameter element (exactly one)
Element named <locationDrift>

Containing:
- Parameter element (exactly one)

Example:

<driftedLocationsStatistic>
  <locations>
    <matrixMatrixProduct idref="matrixMatrixProduct8">
  </locations>
  <offsets>
    <matrixVectorProductParameter idref="matrixVectorProductParameter7">
  </offsets>
  <locationDrift>
    <sumParameter idref="sumParameter5">
  </locationDrift>
</driftedLocationsStatistic>

`<driftedTraits>` element

null

The element has the following contents:

AbstractMultivariateTraitLikelihood element (exactly one)

The tree trait provider which is to be drifted.
Parameter element (exactly one)

The parameter specifying location drift rate.

Example:

<driftedTraits>
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <differenceParameter idref="differenceParameter1">
    </traitParameter>
    <cartogramDiffusionModel idref="cartogramDiffusionModel3">
    <partitionedTreeModel idref="partitionedTreeModel6">
    ERROR!
    ERROR!
    ERROR!
  </multivariateTraitLikelihood>
  <elementWiseMatrixMultiplicationParameter/>
</driftedTraits>

`<dummyLikelihood>` element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.

The element has the following contents:

One of:
- Model element (exactly one)
  
  A model element
- Parameter element (exactly one)
  
  A parameter

Example:

<dummyLikelihood>
  <lewisMk totalOrder="true">
    <frequencies>
      <frequencyModel idref="frequencyModel3">
    </frequencies>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
  </lewisMk>
</dummyLikelihood>

`<dummyModel>` element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.

The element has the following contents:

Parameter elements (one or more)

Example:

<dummyModel>
  <diagonalMatrix>
    <dataFromTreeTips idref="dataFromTreeTips8">
  </diagonalMatrix>
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix1">
    <generalDataType idref="generalDataType3">
  </originDestinationDesignMatrix>
  <blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true">
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
  </blockUpperTriangularMatrixParameter>
  <leafTraitParameter taxon="foo" setBounds="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix7">
  </leafTraitParameter>
</dummyModel>

`<duplicatedParameter>` element

A duplicated parameter.

The element has the following contents:

Parameter element (exactly one)
Element named <copies>

Containing:
- Parameter element (exactly one)

Example:

<duplicatedParameter>
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <designMatrix idref="designMatrix4">
    <extendedDataType idref="extendedDataType1">
  </originDestinationDesignMatrix>
  <copies>
    <productParameter idref="productParameter2">
  </copies>
</duplicatedParameter>

`<elementWiseMatrixMultiplicationParameter>` element

Returns element wise matrix multiplication of a series of matrices

Example:

<elementWiseMatrixMultiplicationParameter/>

`<ellipticalSliceSampler>` element

An elliptical slice sampler for parameters with Gaussian priors.

The element takes following attributes:

weight is of type Double
signalConstituentParameters (optional) is of type Boolean
bracketAngle (optional) is of type Double
translationInvariant (optional) is of type Boolean
rotationInvariant (optional) is of type Boolean
drawByRow (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)
One of:
- GaussianProcessRandomGenerator element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)

Example:

<ellipticalSliceSampler weight="1.0" signalConstituentParameters="true" bracketAngle="1.0" translationInvariant="true" rotationInvariant="true" drawByRow="true">
  <productParameter>
    <jointParameter idref="jointParameter9">
  </productParameter>
  <normalDistributionModel>
    <mean>
      <matrixMatrixProduct idref="matrixMatrixProduct7">
    </mean>
    <precision>
      <productParameter idref="productParameter8">
    </precision>
  </normalDistributionModel>
</ellipticalSliceSampler>

`<emergingEpidemic>` element

A self-consistent model of emerging epidemics.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <growthRate>

Containing:
- Parameter element (exactly one)
Element named <generationTime>

Containing:
- Parameter element (exactly one)
Element named <generationShape>

Containing:
- Parameter element (exactly one)
Element named <offspringDispersion>

Containing:
- Parameter element (exactly one)
Element named <epidemicTree>

Containing:
- Tree element (exactly one)

Example:

<emergingEpidemic units="substitutions">
  <growthRate>
    <compoundMatrixParameter idref="compoundMatrixParameter10">
  </growthRate>
  <generationTime>
    <maskedMatrixParameter idref="maskedMatrixParameter6">
  </generationTime>
  <generationShape>
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix6">
  </generationShape>
  <offspringDispersion>
    <productParameter idref="productParameter1">
  </offspringDispersion>
  <epidemicTree>
    <starTreeModel idref="starTreeModel7">
  </epidemicTree>
</emergingEpidemic>

`<empiricalCodonModel>` element

This element represents the empirical model of codon evolution.

The element takes following attributes:

geneticCode (optional) is of type String

“The genetic code to use”
ecmDataDir (optional) is of type String

“The directory with the ECM data file”
ecmRateFile (optional) is of type String

“The file with the ECM data matrix”
ecmFreqFile (optional) is of type String

“The csv file with the ECM frequency matrix”

The element has the following contents:

Element named <omega>

Containing:
- Parameter element (exactly one)
One of:
- Element named <kappaTsTv>
  
  Containing:
  - Parameter element (exactly one)
- Element named <multiNtChange>
  
  Containing:
  - Parameter element (exactly one)
FrequencyModel element (zero or one)

Example:

<empiricalCodonModel geneticCode="universal" ecmDataDir="ecmdata" ecmRateFile="matrix.csv" ecmFreqFile="freqs.csv">
  <omega>
    <copyParameterValues idref="copyParameterValues4">
  </omega>
  <multiNtChange>
    <fastMatrixParameter idref="fastMatrixParameter7">
  </multiNtChange>
</empiricalCodonModel>

`<empiricalDistributionLikelihood>` element

Calculates the likelihood of some data given some empirically-generated distribution.

The element takes following attributes:

fileName is of type String
splineInterpolation (optional) is of type Boolean
degree (optional) is of type Integer
inverse (optional) is of type Boolean
readByColumn (optional) is of type Boolean

The element has the following contents:

Element named <data>

Containing:
- from (optional) is of type Integer
- to (optional) is of type Integer
- offset (optional) is of type Double
- lower (optional) is of type Double
- upper (optional) is of type Double
- Statistic elements (one or more)

Example:

<empiricalDistributionLikelihood fileName="foo" splineInterpolation="true" degree="1" inverse="true" readByColumn="true">
  <data from="1" to="1" offset="1.0" lower="1.0" upper="1.0">
    <complementParameter idref="complementParameter3">
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix10">
    <thresholdStatistic idref="thresholdStatistic6">
  </data>
</empiricalDistributionLikelihood>

`<empiricalPiecewise>` element

This element represents a piecewise population model

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <intervalWidths>

Containing:
- values is of type Double;
Element named <populationSizes>
The effective population sizes of each interval.
Containing:
- Parameter element (exactly one)
Element named <generationLength>
The scale factor.
Containing:
- Parameter element (exactly one)
Element named <threshold>
The threshold before counts occur.
Containing:
- Parameter element (exactly one)
Element named <lag>
The lag between actual population sizes and genetic diversity.
Containing:
- Parameter element (exactly one)

Example:

<empiricalPiecewise units="generations">
  <intervalWidths values="0.5 1.0"/>
  <populationSizes>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter7">
  </populationSizes>
  <generationLength>
    <matrixParameter idref="matrixParameter2">
  </generationLength>
  <threshold>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
  </threshold>
  <lag>
    <differenceParameter idref="differenceParameter7">
  </lag>
</empiricalPiecewise>

`<empiricalTreeDistributionModel>` element

Read a list of trees from a NEXUS file.

The element takes following attributes:

startingTree (optional) is of type Integer
iterate (optional) is of type Boolean
fileName is of type String

“The name of a NEXUS tree file”

The element has the following contents:

TaxonList element (exactly one)

Example:

<empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
  <ascertainedPatterns from="1" to="1" every="1">
    <convert idref="convert9">
  </ascertainedPatterns>
</empiricalTreeDistributionModel>

`<empiricalTreeDistributionOperator>` element

Operator which switches between trees in an empirical distribution.

The element takes following attributes:

weight is of type Double
metropolisHastings (optional) is of type Boolean

The element has the following contents:

EmpiricalTreeDistributionModel element (exactly one)

Example:

<empiricalTreeDistributionOperator weight="1.0" metropolisHastings="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <rescaledTree idref="rescaledTree10">
  </empiricalTreeDistributionModel>
</empiricalTreeDistributionOperator>

`<epochBranchModel>` element

This element provides a branch model which has multiple epoch. All branches (or portions of them) have the same substitution model within a given epoch. If parameters are used to sample transition times, these must be kept in ascending order by judicious use of bounds or priors.

The element has the following contents:

TreeModel element (exactly one)

The tree across which the epochs will be assigned
SubstitutionModel element (exactly one)

The ancestral substitution model after the last epoch
Element named <epoch>
An epoch that lasts until transitionTime
Containing:
- transitionTime (optional) is of type Double
“The time of transition between this epoch and the previous one”
- SubstitutionModel element (exactly one)
The substitution model for this epoch
- Element named <transitionTime>
The transition time parameter for this epoch
Containing: * [Parameter](#parameter) element (exactly one)

Example:

<epochBranchModel>
  <treeModel fixHeights="true" fixTree="true">
    <rescaledTree idref="rescaledTree2">
    <rootHeight>
      <productParameter idref="productParameter3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <sumParameter idref="sumParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixMatrixProduct idref="matrixMatrixProduct10">
    </nodeHeights>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter10">
    </leafHeight>
    <leafHeight taxon="foo">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix9">
    </leafHeight>
    <leafHeight taxon="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <productParameter idref="productParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <leafTraitParameter idref="leafTraitParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter3">
    </leafTrait>
  </treeModel>
  <complexSubstitutionModel dataType="hiddenCodon2-universal" randomizeIndicator="true" bssvsTolerance="1.0" bssvsScalar="1.0" checkConditioning="true" normalized="true">
    <rootFrequencies>
      <frequencyModel idref="frequencyModel3">
    </rootFrequencies>
    <rates/>
  </complexSubstitutionModel>
  <epoch transitionTime="1.0">
    <markovModulatedYangCodonModel idref="markovModulatedYangCodonModel3">
  </epoch>
  <epoch transitionTime="1.0">
    <pcaCodonModel idref="pcaCodonModel9">
  </epoch>
</epochBranchModel>

`<exponentialStatistic>` element

This element returns a statistic that is the element-wise exponentiation of the child statistic.

The element has the following contents:

Statistic element (exactly one)

Example:

<exponentialStatistic>
  <mvPolyaLikelihood>
    <data>
      <mvPolyaLikelihood idref="mvPolyaLikelihood5">
    </data>
    <alpha>
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </alpha>
  </mvPolyaLikelihood>
</exponentialStatistic>

`<expansion>` element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <ancestralPopulationProportion>

Containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate>
  A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
  Containing:
  - Parameter element (exactly one)
- Element named <doublingTime>
  This parameter determines the doubling time.
  Containing:
  - Parameter element (exactly one)

Example:

<expansion units="substitutions">
  <populationSize>
    <dataFromTreeTips idref="dataFromTreeTips7">
  </populationSize>
  <ancestralPopulationProportion>
    <mvPolyaLikelihood idref="mvPolyaLikelihood8">
  </ancestralPopulationProportion>
  <growthRate>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView9">
  </growthRate>
</expansion>

`<expConstExp>` element

A demographic model of exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <relativePlateauSize>
The size of plateau relative to modern population size.
Containing:
- Parameter element (exactly one)
Element named <relTimeModGrowth>
The time spanned by modern growth phase relative to time back to start of plateau phase.
Containing:
- Parameter element (exactly one)
Element named <plateauStartTime>
The time of the start of plateauPhase.
Containing:
- Parameter element (exactly one)
Element named <ancientGrowthRate>
The growth rate of early growth phase
Containing:
- Parameter element (exactly one)

Example:

<expConstExp units="generations">
  <populationSize>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
  </populationSize>
  <relativePlateauSize>
    <vectorSlice idref="vectorSlice8">
  </relativePlateauSize>
  <relTimeModGrowth>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter1">
  </relTimeModGrowth>
  <plateauStartTime>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
  </plateauStartTime>
  <ancientGrowthRate>
    <fastMatrixParameter idref="fastMatrixParameter2">
  </ancientGrowthRate>
</expConstExp>

`<exponentialDistributionModel>` element

A model of an exponential distribution.

The element takes following attributes:

offset (optional) is of type Double

The element has the following contents:

One of:
- Element named <mean>
  
  Containing:
  - Double element (exactly one)
- Element named <mean>
  
  Containing:
  - Parameter element (exactly one)

Example:

<exponentialDistributionModel offset="1.0">
  <mean>
    <fastMatrixParameter idref="fastMatrixParameter1">
  </mean>
</exponentialDistributionModel>

`<exponentialExponential>` element

A demographic model of exponential growth followed by a different exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <growthRate>

Containing:
- Parameter element (exactly one)
Element named <ancestralGrowthRate>

Containing:
- Parameter element (exactly one)
Element named <transitionTime>

Containing:
- Parameter element (exactly one)

Example:

<exponentialExponential units="years">
  <populationSize>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser9">
  </populationSize>
  <growthRate>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
  </growthRate>
  <ancestralGrowthRate>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
  </ancestralGrowthRate>
  <transitionTime>
    <fastMatrixParameter idref="fastMatrixParameter4">
  </transitionTime>
</exponentialExponential>

`<exponentialGrowth>` element

A demographic model of exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate>
  A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.
  Containing:
  - Parameter element (exactly one)
- Element named <doublingTime>
  This parameter determines the doubling time.
  Containing:
  - Parameter element (exactly one)

Example:

<exponentialGrowth units="substitutions">
  <populationSize>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter3">
  </populationSize>
  <doublingTime>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
  </doublingTime>
</exponentialGrowth>

`<exponentialLogistic>` element

A demographic model of exponential growth followed by logistic growth.

The element takes following attributes:

units is of type String

“the units”
alpha is of type Double

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <logisticGrowthRate>

Containing:
- Parameter element (exactly one)
Element named <logisticShape>

Containing:
- Parameter element (exactly one)
Element named <exponentialGrowthRate>

Containing:
- Parameter element (exactly one)
Element named <transitionTime>

Containing:
- Parameter element (exactly one)

Example:

<exponentialLogistic units="years" alpha="1.0">
  <populationSize>
    <dataFromTreeTips idref="dataFromTreeTips9">
  </populationSize>
  <logisticGrowthRate>
    <leafTraitParameter idref="leafTraitParameter1">
  </logisticGrowthRate>
  <logisticShape>
    <dataFromTreeTips idref="dataFromTreeTips1">
  </logisticShape>
  <exponentialGrowthRate>
    <dataFromTreeTips idref="dataFromTreeTips5">
  </exponentialGrowthRate>
  <transitionTime>
    <copyParameterValues idref="copyParameterValues3">
  </transitionTime>
</exponentialLogistic>

`<exponentialMarkovLikelihood>` element

A continuous state, discrete time markov chain in which each new state is an exponentially distributed variable with a mean of the previous state.

The element takes following attributes:

jeffreys (optional) is of type Boolean
reverse (optional) is of type Boolean

The element has the following contents:

Element named <chainParameter>

Containing:
- Parameter element (exactly one)

Example:

<exponentialMarkovLikelihood jeffreys="true" reverse="true">
  <chainParameter>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </chainParameter>
</exponentialMarkovLikelihood>

`<exponentialPrior>` element

Calculates the prior probability of some data under a given exponential distribution.

The element takes following attributes:

offset (optional) is of type Double

The element has the following contents:

One of:
- scale is of type Double
- mean is of type Double
Statistic elements (one or more)

Example:

<exponentialPrior mean="1.0" offset="1.0">
  <gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood1">
  </gmrfPopSizeStatistic>
</exponentialPrior>

`<exponentialSawtooth>` element

A demographic model of succesive exponential growth and periodic population crashes.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <growthRate>
The rate of exponential growth during the growth phase.
Containing:
- Parameter element (exactly one)
Element named <wavelength>
The wavelength between successive population crashes.
Containing:
- Parameter element (exactly one)
Element named <offset>
The proportion of the last growth phase that is not achieved at the final sample time.
Containing:
- Parameter element (exactly one)

Example:

<exponentialSawtooth units="years">
  <populationSize>
    <diagonalMatrix idref="diagonalMatrix8">
  </populationSize>
  <growthRate>
    <matrixVectorProductParameter idref="matrixVectorProductParameter2">
  </growthRate>
  <wavelength>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
  </wavelength>
  <offset>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter7">
  </offset>
</exponentialSawtooth>

`<exponentialStatistic>` element

This element returns a statistic that is the element-wise exponentiation of the child statistic.

The element has the following contents:

Statistic element (exactly one)

Example:

<exponentialStatistic>
  <nodeHeightsStatistic name="foo">
    <starTreeModel idref="starTreeModel7">
  </nodeHeightsStatistic>
</exponentialStatistic>

`<expressionStatistic>` element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

Element named <expression>

Containing:
- String element (exactly one)
Element named <variables>

Containing:
- Statistic elements (one or more)

Example:

<expressionStatistic>
  <expression>
    foo
  </expression>
  <variables>
    <gmrfPopSizeStatistic idref="gmrfPopSizeStatistic3">
    <duplicatedParameter idref="duplicatedParameter6">
  </variables>
</expressionStatistic>

`<extendedDataType>` element

This element represents an instance of the MutationDeathType which extends a base datatype with an additional “death” state.

The element takes following attributes:

dataType (optional) is of type String

“Base datatype name”

The element has the following contents:

DataType element (zero or one)
Element named <deathState>

Containing:
- code is of type String
Element named <extantState>

Containing:
- code is of type String

: Example:

<extendedDataType dataType="codon-echinodermMitochondrial"/>

`<externalInternalBranchModel>` element

This element provides a branch model which allows different substitution modelson internal and external branches of the tree.

The element has the following contents:

TreeModel element (exactly one)

The tree
SubstitutionModel element (exactly one)

The substitution model for internal branches
Element named <externalBranches>

Containing:
- SubstitutionModel element (exactly one)
  
  The external branch substitution model

Example:

<externalInternalBranchModel>
  <starTreeModel>
    <argTreeModel idref="argTreeModel10">
    <rootHeight>
      <dataFromTreeTips idref="dataFromTreeTips5">
    </rootHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix5">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundParameter idref="compoundParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter6">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <copyParameterValues idref="copyParameterValues3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
    </leafTrait>
  </starTreeModel>
  <empiricalCodonModel geneticCode="invertebrateMitochondrial" ecmDataDir="ecmdata" ecmRateFile="matrix.csv" ecmFreqFile="freqs.csv">
    <omega>
      <productParameter idref="productParameter5">
    </omega>
    <multiNtChange>
      <diagonalMatrix idref="diagonalMatrix1">
    </multiNtChange>
  </empiricalCodonModel>
  <externalBranches>
    <aminoAcidModel idref="aminoAcidModel9">
  </externalBranches>
</externalInternalBranchModel>

`<externalLengthStatistic>` element

A statistic that has as its value(s) the length of the external branch length(s) of a set of one or more taxa in a given tree

The element takes following attributes:

name (optional) is of type String

“A name for this statistic primarily for the purposes of logging”

The element has the following contents:

TreeModel element (exactly one)
Taxa element (exactly one)

Example:

<externalLengthStatistic name="foo">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork5">
    <rootHeight>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    </nodeHeights>
    <leafHeight taxon="foo">
      <designMatrix idref="designMatrix2">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <immutableParameter idref="immutableParameter6">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <compoundMatrixParameter idref="compoundMatrixParameter4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <diagonalMatrix idref="diagonalMatrix4">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <vectorSlice idref="vectorSlice7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues7">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix9">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <fastMatrixParameter idref="fastMatrixParameter9">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak8">
    </outbreak>
  </partitionedTreeModel>
  <taxa>
    <apsp idref="apsp5">
    <apsp idref="apsp5">
  </taxa>
</externalLengthStatistic>

`<fastBlockUpperTriangularMatrixParameterParser>` element

Returns a blockUpperTriangularMatrixParameter which is a compoundParameter which forces the last element to be of full length, the second to last element to be of full length-1, etc.

The element takes following attributes:

transpose (optional) is of type Boolean
columns (optional) is of type Integer
rows (optional) is of type Integer

Example:

<fastBlockUpperTriangularMatrixParameterParser transpose="true" columns="1" rows="1"/>

`<fastMatrixParameter>` element

A fast matrix parameter constructed from a single parameter.

The element takes following attributes:

rows is of type Integer
columns is of type Integer

The element has the following contents:

Parameter elements (zero or more)

Example:

<fastMatrixParameter rows="1" columns="1">
  <fastBlockUpperTriangularMatrixParameterParser transpose="true" columns="1" rows="1"/>
  <jointParameter>
    <maskedMatrixParameter idref="maskedMatrixParameter6">
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter3">
  </jointParameter>
  <compoundParameter>
    <differenceParameter idref="differenceParameter4">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter7">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    <diagonalMatrix idref="diagonalMatrix9">
  </compoundParameter>
</fastMatrixParameter>

`<fireParameterChanged>` element

This element returns a operator that forces the entire model likelihood recomputation

The element takes following attributes:

weight is of type Double

The element has the following contents:

Parameter element (exactly one)

Example:

<fireParameterChanged weight="1.0">
  <vectorSlice sliceDimension="1">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    <leafTraitParameter idref="leafTraitParameter8">
    <parameter idref="parameter8">
  </vectorSlice>
</fireParameterChanged>

`<fixedDriftModel>` element

This element returns a relaxed drift model.

The element has the following contents:

Element named <backboneDrift>
backbone drift rate
Containing:
- Parameter element (exactly one)
Element named <otherDrift>
other drift rate
Containing:
- Parameter element (exactly one)

Example:

<fixedDriftModel>
  <backboneDrift>
    <fastMatrixParameter idref="fastMatrixParameter9">
  </backboneDrift>
  <otherDrift>
    <productParameter idref="productParameter3">
  </otherDrift>
</fixedDriftModel>

`<FixedNodeheightSubtreePruneRegraft>` element

This element represents a FNPR operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

weight is of type Double

The element has the following contents:

TreeModel element (exactly one)

Example:

<FixedNodeheightSubtreePruneRegraft weight="1.0">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <upgmaTree idref="upgmaTree9">
    <rootHeight>
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter8">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <leafTraitParameter idref="leafTraitParameter6">
    </nodeHeights>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter6">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundMatrixParameter idref="compoundMatrixParameter7">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak3">
    </outbreak>
  </partitionedTreeModel>
</FixedNodeheightSubtreePruneRegraft>

`<flatGeoSpatialPrior>` element

Calculates the likelihood of some data under a 2D geospatial distribution.

The element takes following attributes:

taxon (optional) is of type String
inside (optional) is of type Boolean
union (optional) is of type Boolean
cache (optional) is of type Boolean

The element has the following contents:

One of:
- kmlFileName is of type String
- Polygon2D elements (one or more)
Element named <data>

Containing:
- Parameter elements (one or more)

Example:

<flatGeoSpatialPrior taxon="foo" inside="true" union="true" cache="true" kmlFileName="foo">
  <data>
    <compoundParameter idref="compoundParameter6">
    <matrixParameter idref="matrixParameter10">
    <jointParameter idref="jointParameter9">
  </data>
</flatGeoSpatialPrior>

`<frequencyModel>` element

A model of equilibrium base frequencies.

The element takes following attributes:

composition (optional) is of type String

“Composition type”
normalize (optional) is of type Boolean
compress (optional) is of type Boolean

The element has the following contents:

PatternList element (zero or one)

Initial value
One of:
- dataType is of type String
  
  “The type of sequence data”
- DataType element (exactly one)
Element named <frequencies>

Containing:
- Parameter element (exactly one)

Example:

<frequencyModel composition="3x4" normalize="true" compress="true" dataType="codon-mycoplasma">
  <frequencies>
    <matrixMatrixProduct idref="matrixMatrixProduct5">
  </frequencies>
</frequencyModel>

`<gammaDistributionModel>` element

The gamma probability distribution.

The element takes following attributes:

offset (optional) is of type Double

The element has the following contents:

Element named <shape>
Shape parameter
Containing:
- Parameter element (zero or one)
Element named <scale>
Scale parameter
Containing:
- Parameter element (zero or one)
Element named <rate>
Rate parameter
Containing:
- Parameter element (zero or one)
Element named <mean>
Mean parameter
Containing:
- Parameter element (zero or one)

Example:

<gammaDistributionModel offset="1.0">
  <shape/>
</gammaDistributionModel>

`<gammaPrior>` element

Calculates the prior probability of some data under a given gamma distribution.

The element takes following attributes:

shape is of type Double
scale is of type Double
offset (optional) is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<gammaPrior shape="1.0" scale="1.0" offset="1.0">
  <monotonicStatistic order="foo" strictlyMonotic="true">
    <diagonalMatrix idref="diagonalMatrix3">
    <differenceStatistic idref="differenceStatistic8">
    <treeLengthStatistic idref="treeLengthStatistic8">
    <copyParameterValues idref="copyParameterValues1">
  </monotonicStatistic>
  <subStatistic dimension="1 2 4 8">
    <matrixParameter idref="matrixParameter4">
  </subStatistic>
  <elementWiseMatrixMultiplicationParameter/>
</gammaPrior>

`<gammaReferencePrior>` element

Calculates the reference prior probability of some data under a given normal distribution.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
burnin is of type Integer

The element has the following contents:

Statistic elements (one or more)

Example:

<gammaReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <negativeStatistic>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser10">
  </negativeStatistic>
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood8">
  </continuousDiffusionStatistic>
</gammaReferencePrior>

`<gammaReferencePrior>` element

Calculates the reference prior probability of some data under a given normal distribution.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
burnin is of type Integer

The element has the following contents:

Statistic elements (one or more)

Example:

<gammaReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <complementParameter>
    <mvPolyaLikelihood idref="mvPolyaLikelihood9">
  </complementParameter>
  <parameter value="0.5 1.0" dimension="1" fileName="foo" parameterColumn="foo" burnin="1" upper="0.5 1.0" lower="0.5 1.0"/>
</gammaReferencePrior>

`<gaussianProcessFromTree>` element

Returns a random draw of traits given a trait model and a prior

The element has the following contents:

FullyConjugateMultivariateTraitLikelihood element (exactly one)

Example:

<gaussianProcessFromTree>
  ERROR!
</gaussianProcessFromTree>

`<gaussianProcessOperator>` element

This element returns a multivariate normal random walk operator on a given parameter.

The element takes following attributes:

scaleFactor is of type Double
weight is of type Double
autoOptimize (optional) is of type Boolean
translationInvariant (optional) is of type Boolean
rotationInvariant (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)
GaussianProcessRandomGenerator element (exactly one)

Example:

<gaussianProcessOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" translationInvariant="true" rotationInvariant="true">
  <buildCompoundSymmetricMatrix/>
  <normalDistributionModel>
    <mean>
      1.0
    </mean>
    <precision>
      <differenceParameter idref="differenceParameter9">
    </precision>
  </normalDistributionModel>
</gaussianProcessOperator>

`<generalDataType>` element

Defines a general DataType for any number of states

The element has the following contents:

Identifiable elements (zero or more)

:: Example:

<!-- The XML for a nucleotide data type under this scheme would be -->
<generalDataType id="nucleotides">
	<state code="A"/>
	<state code="C"/>
	<state code="G"/>
	<state code="T"/>
	<alias code="U" state="T"/>
	<ambiguity code="R" states="AG"/>
	<ambiguity code="Y" states="CT"/>
	<ambiguity code="?" states="ACGT"/>
	<ambiguity code="-" states="ACGT"/>
</generalDataType>

`<generalizedSkylineGibbsOperator>` element

This element returns a Gibbs operator for the joint distribution of population sizes.

The element takes following attributes:

linear (optional) is of type Boolean
weight is of type Double
lower is of type Double
upper is of type Double
Jeffreys (optional) is of type Boolean
reverse (optional) is of type Boolean
exponentialMarkov (optional) is of type Boolean
shape is of type Double

The element has the following contents:

BayesianSkylineLikelihood element (exactly one)
Parameter element (exactly one)

Example:

<generalizedSkylineGibbsOperator linear="true" weight="1.0" lower="1.0" upper="1.0" Jeffreys="true" reverse="true" exponentialMarkov="true" shape="1.0">
  <generalizedSkyLineLikelihood linear="true">
    <populationSizes>
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </populationSizes>
    <groupSizes>
      <jointParameter idref="jointParameter6">
    </groupSizes>
    <populationTree>
      <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
    </populationTree>
  </generalizedSkyLineLikelihood>
  <matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter4">
  </matrixParameter>
</generalizedSkylineGibbsOperator>

`<generalizedSkyLineLikelihood>` element

This element represents the likelihood of the tree given the population size vector.

The element has the following contents:

One of:
- linear is of type Boolean
- type is of type String
Element named <populationSizes>

Containing:
- Parameter element (exactly one)
Element named <groupSizes>

Containing:
- Parameter element (exactly one)
Element named <populationTree>

Containing:
- TreeModel element (exactly one)

Example:

<generalizedSkyLineLikelihood linear="true">
  <populationSizes>
    <fastMatrixParameter idref="fastMatrixParameter7">
  </populationSizes>
  <groupSizes>
    <mvPolyaLikelihood idref="mvPolyaLikelihood1">
  </groupSizes>
  <populationTree>
    <starTreeModel idref="starTreeModel2">
  </populationTree>
</generalizedSkyLineLikelihood>

`<generalizedSkylinePopSizeStatistic>` element

The pop sizes at the given times

Example:

<generalizedSkylinePopSizeStatistic/>

`<generalizedSteppingStoneSamplingAnalysis>` element

Performs a trace analysis.

The element takes following attributes:

fileName is of type String

“The traceName of a BEAST log file (can not include trees, which should be logged separately)”
resultsFileName (optional) is of type String

“The name of the output file to which the generalized stepping-stone sampling estimate will be written”

The element has the following contents:

Element named <thetaColumn>

Containing:
- name is of type String
  
  “The column name”
Element named <sourceColumn>

Containing:
- name is of type String
  
  “The column name”
Element named <destinationColumn>

Containing:
- name is of type String
  
  “The column name”

Example:

<generalizedSteppingStoneSamplingAnalysis fileName="foo" resultsFileName="foo">
  <thetaColumn name="foo"/>
  <sourceColumn name="foo"/>
  <destinationColumn name="foo"/>
</generalizedSteppingStoneSamplingAnalysis>

`<generalSubstitutionModel>` element

A general reversible model of sequence substitution for any data type.

The element takes following attributes:

randomizeIndicator (optional) is of type Boolean

The element has the following contents:

One of:
- dataType is of type String
  
  “The type of sequence data”
- DataType element (exactly one)
Element named <frequencies>

Containing:
- FrequencyModel element (exactly one)
Element named <rates>

Containing:
- Parameter element (exactly one)
Element named <rateIndicator>

Containing:
- Parameter element (exactly one)

Example:

<generalSubstitutionModel randomizeIndicator="true">
  <hiddenNucleotides classCount="1"/>
  <frequencies>
    <frequencyModel idref="frequencyModel3">
  </frequencies>
  <rates>
    <vectorSlice idref="vectorSlice2">
  </rates>
</generalSubstitutionModel>

`<geoDistributionCollection>` element

An operator that picks new parameter values uniformly at random.

The element has the following contents:

MultivariateDistributionLikelihood elements (zero or more)
CachedDistributionLikelihood elements (zero or more)

Example:

<geoDistributionCollection>
  <multivariateNormalPrior>
    <meanParameter>
      <compoundMatrixParameter idref="compoundMatrixParameter2">
    </meanParameter>
    <precisionParameter>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    </precisionParameter>
    <composedTransform idref="composedTransform4">
  </multivariateNormalPrior>
  <dirichletPrior alpha="0.5 1.0" sumsTo="1.0">
    <ratioStatistic idref="ratioStatistic1">
    <popGraph idref="popGraph8">
    <reciprocalStatistic idref="reciprocalStatistic5">
  </dirichletPrior>
  <multivariateDistributionLikelihood dataAsMatrix="true">
    <distribution>
      <treeTraitNormalDistribution idref="treeTraitNormalDistribution8">
    </distribution>
    <transform idref="transform2">
    <inverseTransform idref="inverseTransform10">
  </multivariateDistributionLikelihood>
  ERROR!
</geoDistributionCollection>

`<GibbsIndependentCoalescentOperator>` element

This element returns an independence coalescent sampler, disguised as a Gibbs operator, from a demographic model.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Taxa element (exactly one)
TreeModel element (exactly one)
DemographicModel element (exactly one)
CoalescentLikelihood element (exactly one)

Example:

<GibbsIndependentCoalescentOperator weight="1.0">
  <taxa>
    <taxa idref="taxa5">
  </taxa>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <partitionedTreeModel idref="partitionedTreeModel3">
    <rootHeight>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter3">
    </nodeHeights>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter7">
    </leafHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix2">
    </leafHeight>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter8">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix2">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <immutableParameter idref="immutableParameter3">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter6">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </nodeRates>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak3">
    </outbreak>
  </partitionedTreeModel>
  <constantLogistic units="years" alpha="1.0">
    <populationSize>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView4">
    </populationSize>
    <ancestralPopulationSize>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </ancestralPopulationSize>
    <growthRate>
      <parameter idref="parameter6">
    </growthRate>
    <shape>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
    </shape>
  </constantLogistic>
  <coalescentLikelihood>
    <model>
      <transmissionModel idref="transmissionModel8">
    </model>
    <populationTree factor="1.0">
      <starTreeModel idref="starTreeModel8">
    </populationTree>
    <populationTree factor="1.0">
      <treeModel idref="treeModel5">
    </populationTree>
    <populationTree factor="1.0">
      <treeModel idref="treeModel10">
    </populationTree>
  </coalescentLikelihood>
</GibbsIndependentCoalescentOperator>

`<GibbsIndependentGammaOperator>` element

This element returns an independence sampler, disguised as a Gibbs operator, from a provided gamma prior.

The element takes following attributes:

weight is of type Double
shape is of type Double
scale is of type Double

The element has the following contents:

Parameter element (exactly one)

Example:

<GibbsIndependentGammaOperator weight="1.0" shape="1.0" scale="1.0">
  <hiddenClassRewardParameter class="1" name="foo">
    <markovModulatedSubstitutionModel idref="markovModulatedSubstitutionModel8">
  </hiddenClassRewardParameter>
</GibbsIndependentGammaOperator>

`<GibbsIndependentNormalDistributionOperator>` element

This element returns an independence sampler, disguised as a Gibbs operator, from a provided normal distribution model.

The element takes following attributes:

weight is of type Double

The element has the following contents:

NormalDistributionModel element (exactly one)
Parameter element (exactly one)

Example:

<GibbsIndependentNormalDistributionOperator weight="1.0">
  <normalDistributionModel>
    <mean>
      <parameter idref="parameter10">
    </mean>
    <precision>
      <duplicatedParameter idref="duplicatedParameter1">
    </precision>
  </normalDistributionModel>
  <compoundMatrixParameter>
    <mvPolyaLikelihood idref="mvPolyaLikelihood5">
    <dataFromTreeTips idref="dataFromTreeTips7">
    <maskedMatrixParameter idref="maskedMatrixParameter3">
  </compoundMatrixParameter>
</GibbsIndependentNormalDistributionOperator>

`<GibbsPruneAndRegraft>` element

This element represents a Gibbs sampler implemented through a prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution which is the proportion of the likelihoods of the proposals.

The element takes following attributes:

weight is of type Double
pruned is of type Boolean

The element has the following contents:

TreeModel element (exactly one)

Example:

<GibbsPruneAndRegraft weight="1.0" pruned="true">
  <treeModel fixHeights="true" fixTree="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
    <rootHeight>
      <differenceParameter idref="differenceParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundParameter idref="compoundParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter6">
    </nodeHeights>
    <leafHeight taxon="foo">
      <maskedParameter idref="maskedParameter10">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision3">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter5">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
    </nodeTraits>
    <leafTrait taxon="foo" name="foo">
      <duplicatedParameter idref="duplicatedParameter2">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <diagonalMatrix idref="diagonalMatrix10">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <productParameter idref="productParameter7">
    </leafTrait>
  </treeModel>
</GibbsPruneAndRegraft>

`<gibbsSampleMissingTraitsOperator>` element

This element returns an independence coalescent sampler from a demographic model.

The element takes following attributes:

weight is of type Double
traitName (optional) is of type String

The element has the following contents:

TreeDataLikelihood element (exactly one)
Parameter element (exactly one)
Element named <missingIndicator>

Containing:
- Parameter element (exactly one)

Example:

<gibbsSampleMissingTraitsOperator weight="1.0" traitName="foo">
  <newTreeDataLikelihood useAmbiguities="true" scalingScheme="foo">
    <maskedPatterns idref="maskedPatterns1">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
  </newTreeDataLikelihood>
  <fastMatrixParameter rows="1" columns="1">
    <immutableParameter idref="immutableParameter3">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    <parameter idref="parameter7">
    <parameter idref="parameter4">
  </fastMatrixParameter>
  <missingIndicator>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix9">
  </missingIndicator>
</gibbsSampleMissingTraitsOperator>

`<GibbsSubtreeSwap>` element

This element represents a Gibbs wide exchange operator. This operator swaps two subtrees chosen to their posterior probaility.

The element takes following attributes:

weight is of type Double
pruned (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)

Example:

<GibbsSubtreeSwap weight="1.0" pruned="true">
  <starTreeModel>
    <rescaledTree idref="rescaledTree10">
    <rootHeight>
      <jointParameter idref="jointParameter1">
    </rootHeight>
    <leafHeight taxon="foo">
      <jointParameter idref="jointParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </leafHeight>
  </starTreeModel>
</GibbsSubtreeSwap>

`<glmModel>` element

Calculates the generalized linear model likelihood of the dependent parameters given one or more blocks of independent parameters and their design matrix.

The element takes following attributes:

family is of type String
checkIdentifiability (optional) is of type Boolean
checkFullRank (optional) is of type Boolean

The element has the following contents:

Element named <dependentVariables>

Containing:
- Parameter element (exactly one)
Element named <independentVariables>

Containing:
- Parameter element (zero or one)
- DesignMatrix element (exactly one)
- Element named <indicator>
  
  Containing:
  - Parameter element (exactly one)
Element named <randomEffects>

Containing:
- Parameter element (exactly one)

Example:

<glmModel family="foo" checkIdentifiability="true" checkFullRank="true">
  <independentVariables>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
  </independentVariables>
  <independentVariables>
    <designMatrix idref="designMatrix5">
  </independentVariables>
  <randomEffects>
    <productParameter idref="productParameter4">
  </randomEffects>
  <randomEffects>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser5">
  </randomEffects>
</glmModel>

`<glmModelNew>` element

Calculates the generalized linear model likelihood of the dependent parameters given one or more blocks of independent parameters and their design matrix.

The element takes following attributes:

checkIdentifiability (optional) is of type Boolean
checkFullRank (optional) is of type Boolean

The element has the following contents:

Element named <model>

Containing:
- linkFunction is of type String
- ParametricDistributionModel element (exactly one)
Element named <dependentVariables>

Containing:
- Parameter element (exactly one)
Element named <independentVariables>

Containing:
- Parameter element (zero or one)
- DesignMatrix element (exactly one)
- Element named <indicator>
  
  Containing:
  - Parameter element (exactly one)
Element named <randomEffects>

Containing:
- Parameter element (exactly one)

Example:

<glmModelNew checkIdentifiability="true" checkFullRank="true">
  <model linkFunction="foo">
    <scaledBetaDistributionModel idref="scaledBetaDistributionModel1">
  </model>
  <dependentVariables>
    <productParameter idref="productParameter8">
  </dependentVariables>
  <independentVariables>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix7">
  </independentVariables>
  <randomEffects>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
  </randomEffects>
  <randomEffects>
    <parameter idref="parameter6">
  </randomEffects>
</glmModelNew>

`<glmSubstitutionModel>` element

A general model of sequence substitution for any data type where the rates come from the generalized linear model.

The element has the following contents:

One of:
- dataType is of type String
  
  “The type of sequence data”
- DataType element (exactly one)
Element named <rootFrequencies>

Containing:
- FrequencyModel element (exactly one)
GeneralizedLinearModel element (exactly one)

Example:

<glmSubstitutionModel dataType="codon-noStops">
  <rootFrequencies>
    <frequencyModel idref="frequencyModel8">
  </rootFrequencies>
  <multivariateOUModel>
    <positiveDefiniteSubstitutionModel idref="positiveDefiniteSubstitutionModel7">
    <maskedMatrixParameter idref="maskedMatrixParameter3">
    <data>
      <sumParameter idref="sumParameter9">
    </data>
    <times>
      <matrixVectorProductParameter idref="matrixVectorProductParameter10">
    </times>
    <design>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    </design>
    <independentVariables>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix5">
    </independentVariables>
  </multivariateOUModel>
</glmSubstitutionModel>

`<glmSubstitutionModelNew>` element

A general model of sequence substitution for any data type where the rates come from the generalized linear model.

The element has the following contents:

One of:
- dataType is of type String
  
  “The type of sequence data”
- DataType element (exactly one)
Element named <rootFrequencies>

Containing:
- FrequencyModel element (exactly one)
GeneralizedLinearModel element (exactly one)

Example:

<glmSubstitutionModelNew dataType="hiddenAminoAcid1">
  <rootFrequencies>
    <frequencyModel idref="frequencyModel5">
  </rootFrequencies>
  <glmModelNew checkIdentifiability="true" checkFullRank="true">
    <model linkFunction="foo">
      <poissonDistributionModel idref="poissonDistributionModel9">
    </model>
    <dependentVariables>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix6">
    </dependentVariables>
    <independentVariables>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
    </independentVariables>
    <independentVariables>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
    </independentVariables>
    <randomEffects>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    </randomEffects>
    <randomEffects>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix1">
    </randomEffects>
  </glmModelNew>
</glmSubstitutionModelNew>

`<gmrfBivariateCurveAnalysis>` element

Integrates two curves

The element takes following attributes:

fileName1 is of type String
fileName2 is of type String
endTime is of type String
burnIn (optional) is of type Integer

Example:

<gmrfBivariateCurveAnalysis fileName1="foo" fileName2="foo" endTime="foo" burnIn="1"/>

`<gmrfBlockUpdateOperator>` element

This element returns a GMRF block-update operator for the joint distribution of the population sizes and precision parameter.

The element takes following attributes:

scaleFactor is of type Double
weight is of type Double
autoOptimize (optional) is of type Boolean
stopValue (optional) is of type Double
maxIterations (optional) is of type Integer
oldSkyride (optional) is of type Boolean

The element has the following contents:

GMRFSkyrideLikelihood element (exactly one)

Example:

<gmrfBlockUpdateOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" stopValue="1.0" maxIterations="1" oldSkyride="true">
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision3">
    </populationSizes>
    <precisionParameter>
      <productParameter idref="productParameter9">
    </precisionParameter>
    <populationTree>
      <starTreeModel idref="starTreeModel3">
    </populationTree>
  </gmrfSkyrideLikelihood>
</gmrfBlockUpdateOperator>

`<gmrfFixedEffectsGibbsOperator>` element

This element returns a Gibbs operator for regression coefficients in a GMRF.

The element takes following attributes:

weight is of type Double

The element has the following contents:

MultivariateDistributionLikelihood element (exactly one)
Parameter element (exactly one)
GMRFSkyrideLikelihood element (exactly one)

Example:

<gmrfFixedEffectsGibbsOperator weight="1.0">
  <treeTraitNormalDistributionLikelihood>
    <treeTraitNormalDistribution idref="treeTraitNormalDistribution10">
    <data>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter9">
      <compoundParameter idref="compoundParameter5">
      <diagonalMatrix idref="diagonalMatrix10">
      <designMatrix idref="designMatrix4">
    </data>
  </treeTraitNormalDistributionLikelihood>
  <elementWiseMatrixMultiplicationParameter/>
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <matrixParameter idref="matrixParameter8">
    </populationSizes>
    <precisionParameter>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </precisionParameter>
    <populationTree>
      <partitionedTreeModel idref="partitionedTreeModel10">
      <partitionedTreeModel idref="partitionedTreeModel4">
      <partitionedTreeModel idref="partitionedTreeModel7">
      <treeModel idref="treeModel9">
    </populationTree>
  </gmrfSkyrideLikelihood>
</gmrfFixedEffectsGibbsOperator>

`<gmrfBlockUpdateOperator>` element

This element returns a GMRF block-update operator for the joint distribution of the population sizes and precision parameter.

The element takes following attributes:

scaleFactor is of type Double
weight is of type Double
autoOptimize (optional) is of type Boolean
stopValue (optional) is of type Double
maxIterations (optional) is of type Integer
oldSkyride (optional) is of type Boolean

The element has the following contents:

GMRFSkyrideLikelihood element (exactly one)

Example:

<gmrfBlockUpdateOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" stopValue="1.0" maxIterations="1" oldSkyride="true">
  <gmrfTestLikelihood>
    <populationSizes>
      <duplicatedParameter idref="duplicatedParameter5">
    </populationSizes>
    <precisionParameter>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter5">
    </precisionParameter>
    <lambdaParameter>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision8">
    </lambdaParameter>
  </gmrfTestLikelihood>
</gmrfBlockUpdateOperator>

`<gmrfHeightsStatistic>` element

A statistic that returns the heights of each internal node in increasing order (or groups them by a group size parameter)

The element takes following attributes:

name (optional) is of type String

The element has the following contents:

GMRFSkyrideLikelihood element (exactly one)

Example:

<gmrfHeightsStatistic name="foo">
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <matrixParameter idref="matrixParameter3">
    </populationSizes>
    <precisionParameter>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </precisionParameter>
    <populationTree>
      <partitionedTreeModel idref="partitionedTreeModel10">
    </populationTree>
  </gmrfSkyrideLikelihood>
</gmrfHeightsStatistic>

`<gmrfPopSizeStatistic>` element

The pop sizes at the given times

The element takes following attributes:

from (optional) is of type Double
to (optional) is of type Double
number (optional) is of type Integer
time (optional) is of type Double;

The element has the following contents:

GMRFSkyrideLikelihood element (exactly one)

Example:

<gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
  <gmrfTestLikelihood>
    <populationSizes>
      <compoundMatrixParameter idref="compoundMatrixParameter6">
    </populationSizes>
    <precisionParameter>
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </precisionParameter>
    <lambdaParameter>
      <designMatrix idref="designMatrix2">
    </lambdaParameter>
  </gmrfTestLikelihood>
</gmrfPopSizeStatistic>

`<gmrfSkyrideLikelihood>` element

This element represents the likelihood of the tree given the population size vector.

The element takes following attributes:

rescaleByRootHeight (optional) is of type Boolean
randomizeTree (optional) is of type Boolean
timeAwareSmoothing (optional) is of type Boolean
oldSkyride (optional) is of type Boolean

The element has the following contents:

Element named <populationSizes>

Containing:
- Parameter element (exactly one)
Element named <precisionParameter>

Containing:
- Parameter element (exactly one)
Element named <phiParameter>

Containing:
- Parameter element (exactly one)
Element named <populationTree>

Containing:
- TreeModel elements (one or more)
Element named <groupSizes>

Containing:
- Parameter element (exactly one)
Element named <singleBeta>

Containing:
- Parameter element (exactly one)

Example:

<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
  <populationSizes>
    <compoundParameter idref="compoundParameter5">
  </populationSizes>
  <precisionParameter>
    <leafTraitParameter idref="leafTraitParameter9">
  </precisionParameter>
  <populationTree>
    <treeModel idref="treeModel5">
    <partitionedTreeModel idref="partitionedTreeModel10">
    <partitionedTreeModel idref="partitionedTreeModel7">
  </populationTree>
</gmrfSkyrideLikelihood>

`<gmrfSkyrideLikelihood>` element

This element represents the likelihood of the tree given the population size vector.

The element takes following attributes:

rescaleByRootHeight (optional) is of type Boolean
randomizeTree (optional) is of type Boolean
timeAwareSmoothing (optional) is of type Boolean
oldSkyride (optional) is of type Boolean

The element has the following contents:

Element named <populationSizes>

Containing:
- Parameter element (exactly one)
Element named <precisionParameter>

Containing:
- Parameter element (exactly one)
Element named <phiParameter>

Containing:
- Parameter element (exactly one)
Element named <populationTree>

Containing:
- TreeModel elements (one or more)
Element named <groupSizes>

Containing:
- Parameter element (exactly one)
Element named <singleBeta>

Containing:
- Parameter element (exactly one)

Example:

<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
  <populationSizes>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
  </populationSizes>
  <precisionParameter>
    <immutableParameter idref="immutableParameter4">
  </precisionParameter>
  <populationTree>
    <partitionedTreeModel idref="partitionedTreeModel4">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
  </populationTree>
</gmrfSkyrideLikelihood>

`<gmrfTestLikelihood>` element

This element represents the likelihood of the tree given the population size vector.

The element has the following contents:

Element named <populationSizes>

Containing:
- Parameter element (exactly one)
Element named <precisionParameter>

Containing:
- Parameter element (exactly one)
Element named <lambdaParameter>

Containing:
- Parameter element (exactly one)

Example:

<gmrfTestLikelihood>
  <populationSizes>
    <differenceMatrixParameter idref="differenceMatrixParameter5">
  </populationSizes>
  <precisionParameter>
    <matrixVectorProductParameter idref="matrixVectorProductParameter1">
  </precisionParameter>
  <lambdaParameter>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
  </lambdaParameter>
</gmrfTestLikelihood>

`<gradient>` element

null

The element has the following contents:

One of:
- DistributionLikelihood element (exactly one)
- MultivariateDistributionLikelihood element (exactly one)

Example:

<gradient>
  <multivariateNormalPrior>
    <meanParameter>
      <maskedParameter idref="maskedParameter3">
    </meanParameter>
    <precisionParameter>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView3">
    </precisionParameter>
  </multivariateNormalPrior>
</gradient>

`<greatCircleDiffusionModel>` element

Describes a bivariate diffusion process using great circle distances.

The element has the following contents:

Parameter element (exactly one)
Element named <diffusionCoefficient>

Containing:
- Parameter element (exactly one)

Example:

<greatCircleDiffusionModel>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <mvPolyaLikelihood idref="mvPolyaLikelihood10">
  </maskedMatrixParameter>
</greatCircleDiffusionModel>

`<gtrModel>` element

A general reversible model of nucleotide sequence substitution.

The element has the following contents:

Element named <frequencies>

Containing:
- FrequencyModel element (exactly one)
Element named <rates>

Containing:
- Parameter element (exactly one)
Element named <rateAC>

Containing:
- Variable element (exactly one)
Element named <rateAG>

Containing:
- Variable element (exactly one)
Element named <rateAT>

Containing:
- Variable element (exactly one)
Element named <rateCG>

Containing:
- Variable element (exactly one)
Element named <rateCT>

Containing:
- Variable element (exactly one)
Element named <rateGT>

Containing:
- Variable element (exactly one)

Example:

<!-- A general time reversible model for DNA.                                          -->
<!-- This element must have parameters for exactly five of the six rates               -->
<!-- The sixth rate has an implied value of 1.0 and all other rates are relative to it -->
<!-- This example parameterizes the rate matrix relative to the A<->G transition       -->
<gtrModel id="gtr1">
	<frequencies> <frequencyModel idref="freqs"/> </frequencies>
	<rateAC> <parameter id="rateAC" value="1.0"/> </rateAC>
	<rateAT> <parameter id="rateAT" value="1.0"/> </rateAT>
	<rateCG> <parameter id="rateCG" value="1.0"/> </rateCG>
	<rateCT> <parameter id="rateCT" value="1.0"/> </rateCT>
	<rateGT> <parameter id="rateGT" value="1.0"/> </rateGT>
</gtrModel>

`<halfNormalPrior>` element

Calculates the prior probability of some data under a given half-normal distribution.

The element takes following attributes:

mean is of type Double
stdev is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<halfNormalPrior mean="1.0" stdev="1.0">
  <gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood3">
  </gmrfPopSizeStatistic>
  <treeMetricStatistic name="foo" type="foo">
    <target>
      <treeModel idref="treeModel6">
    </target>
    <reference>
      <neighborJoiningTree idref="neighborJoiningTree8">
    </reference>
  </treeMetricStatistic>
  <argReassortmentNodeCount name="foo">
    <argTreeModel idref="argTreeModel4">
  </argReassortmentNodeCount>
</halfNormalPrior>

`<halfTPrior>` element

Calculates the prior probability of some data under a given half-T distribution.

The element takes following attributes:

scale is of type Double
df is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<halfTPrior scale="1.0" df="1.0">
  <diffusionRateCovarianceStatistic name="foo" greatCircleDistance="true" diffusionCoefficient="true">
    <starTreeModel idref="starTreeModel2">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood6">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood3">
    <inhibitionLikelihood idref="inhibitionLikelihood8">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood2">
  </diffusionRateCovarianceStatistic>
</halfTPrior>

`<HamiltonianMonteCarloOperator>` element

Returns a Hamiltonian Monte Carlo transition kernel

The element takes following attributes:

weight is of type Double
nSteps is of type Integer
stepSize is of type Double
drawVariance is of type Double
autoOptimize (optional) is of type Boolean
mode (optional) is of type Integer

The element has the following contents:

Parameter element (exactly one)
Transform$MultivariableTransformWithParameter element (zero or one)
GradientWrtParameterProvider element (exactly one)

Example:

<HamiltonianMonteCarloOperator weight="1.0" nSteps="1" stepSize="1.0" drawVariance="1.0" autoOptimize="true" mode="1">
  <approximateFactorAnalysisPrecision>
    <L>
      <designMatrix idref="designMatrix9">
    </L>
    <gamma>
      <matrixParameter idref="matrixParameter10">
    </gamma>
  </approximateFactorAnalysisPrecision>
  <gradient>
    <multivariateNormalPrior idref="multivariateNormalPrior2">
  </gradient>
</HamiltonianMonteCarloOperator>

`<harmonicMeanAnalysis>` element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

fileName is of type String

“The traceName of a BEAST log file (can not include trees, which should be logged separately”
burnIn (optional) is of type Integer
bootstrapLength (optional) is of type Integer
smoothedEstimate (optional) is of type Boolean

The element has the following contents:

Element named <likelihoodColumn>

Containing:
- name is of type String
  
  “The column name”

Example:

<harmonicMeanAnalysis fileName="foo" burnIn="1" bootstrapLength="1" smoothedEstimate="true">
  <likelihoodColumn name="foo"/>
</harmonicMeanAnalysis>

`<hiddenClassRewardParameter>` element

Generates a reward parameter to log hidden classes in Markov-modulated substitutionProcess

The element takes following attributes:

class is of type Integer
name (optional) is of type String

The element has the following contents:

MarkovModulatedSubstitutionModel element (exactly one)

Example:

<hiddenClassRewardParameter class="1" name="foo">
  <markovModulatedSubstitutionModel dataType="foo" geometricRates="true" renormalize="true">
    <switchingRates>
      <fastMatrixParameter idref="fastMatrixParameter8">
    </switchingRates>
    <lewisMk idref="lewisMk5">
    <hkyModel idref="hkyModel9">
    <yangCodonModel idref="yangCodonModel6">
  </markovModulatedSubstitutionModel>
</hiddenClassRewardParameter>

`<hiddenNucleotides>` element

A nucleotide data type that allows hidden substitution classes

The element takes following attributes:

classCount is of type Integer

Example:

<hiddenNucleotides classCount="1"/>

`<HierarchicalBitFlipOperator>` element

This element returns a bit-flip operator on a set of hierarchical and strata parameters simulatneously.

The element takes following attributes:

weight is of type Double
usesPriorOnSum (optional) is of type Boolean

The element has the following contents:

Element named <hParameter>

Containing:
- Parameter element (exactly one)
Element named <strataParameters>

Containing:
- Parameter elements (one or more)

Example:

<HierarchicalBitFlipOperator weight="1.0" usesPriorOnSum="true">
  <hParameter>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
  </hParameter>
  <strataParameters>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter6">
    <matrixVectorProductParameter idref="matrixVectorProductParameter4">
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter10">
  </strataParameters>
</HierarchicalBitFlipOperator>

`<hierarchicalGraphLikelihood>` element

Calculates the likelihood of strata graph given hierarchical graph and p.

The element has the following contents:

Element named <hierarchicalIndicator>

Containing:
- Parameter element (exactly one)
Element named <strataIndicator>

Containing:
- Parameter elements (one or more)
Element named <prob>

Containing:
- Parameter element (exactly one)

Example:

<hierarchicalGraphLikelihood>
  <hierarchicalIndicator>
    <maskedMatrixParameter idref="maskedMatrixParameter3">
  </hierarchicalIndicator>
  <strataIndicator>
    <maskedMatrixParameter idref="maskedMatrixParameter10">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix4">
    <parameter idref="parameter7">
    <jointParameter idref="jointParameter7">
  </strataIndicator>
  <prob>
    <matrixVectorProductParameter idref="matrixVectorProductParameter2">
  </prob>
</hierarchicalGraphLikelihood>

`<hierarchicalPartitionLikelihood>` element

null

The element has the following contents:

ARGModel element (exactly one)

Example:

<hierarchicalPartitionLikelihood>
  <argTreeModel partitionType="reassortment">
    <rescaledTree idref="rescaledTree2">
    <rootHeight>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixMatrixProduct idref="matrixMatrixProduct5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice6">
    </nodeHeights>
  </argTreeModel>
</hierarchicalPartitionLikelihood>

`<hierarchicalTransmissionModel>` element

A SiteModel that has a gamma distributed rates across sites

The element takes following attributes:

units is of type String

“the units”
hostCount is of type Integer

The element has the following contents:

One of:
- Element named <constant>
  
  Containing:
  - Element named <populationSize>
    This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.
    Containing:
    
    Parameter element (exactly one)
- One of:
  - Element named <exponential>
    
    Containing:
    - One of:
      - Element named <growthRate>
        
        This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
        Containing:
        
        Parameter element (exactly one)
      - Element named <doublingTime>
        
        This parameter determines the doubling time at peak growth rate.
        Containing:
        
        Parameter element (exactly one)
    - Element named <ancestralProportion>
      
      This parameter determines the populaation size at transmission.
      Containing:
      
      Parameter element (exactly one)
  - Element named <logistic>
    
    Containing:
    - Element named <populationSize>
      
      This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.
      Containing:
      
      Parameter element (exactly one)
    - One of:
      - Element named <growthRate>
        
        This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
        Containing:
        
        Parameter element (exactly one)
      - Element named <doublingTime>
        
        This parameter determines the doubling time at peak growth rate.
        Containing:
        
        Parameter element (exactly one)
    - Element named <ancestralProportion>
      
      This parameter determines the populaation size at transmission.
      Containing:
      
      Parameter element (exactly one)

Example:

<hierarchicalTransmissionModel units="generations" hostCount="1">
  <exponential>
    <doublingTime>
      <dataFromTreeTips idref="dataFromTreeTips3">
    </doublingTime>
    <ancestralProportion>
      <differenceParameter idref="differenceParameter5">
    </ancestralProportion>
  </exponential>
</hierarchicalTransmissionModel>

`<historyFilter>` element

A logger to filter transitions in the complete history.

The element takes following attributes:

maxTime (optional) is of type Double
minTime (optional) is of type Double

The element has the following contents:

Element named <sources>

Containing:
- One of:
  - includeAll (optional) is of type Boolean
  - Identifiable elements (one or more)
Element named <destinations>

Containing:
- One of:
  - includeAll (optional) is of type Boolean
  - Identifiable elements (one or more)

Example:

<historyFilter maxTime="1.0" minTime="1.0"/>

`<hkyModel>` element

This element represents an instance of the HKY85 (Hasegawa, Kishino & Yano, 1985) model of nucleotide evolution.

The element has the following contents:

Element named <frequencies>

Containing:
- FrequencyModel element (exactly one)
Element named <kappa>

Containing:
- Parameter element (exactly one)

Example:

<hkyModel>
  <frequencies>
    <frequencyModel idref="frequencyModel8">
  </frequencies>
  <kappa>
    <maskedParameter idref="maskedParameter6">
  </kappa>
</hkyModel>

`<hybPopSizesScaleOperator>` element

Operator which scales the population size of a newly formed hybrid.

The element takes following attributes:

weight is of type Double
scaleFactor is of type Double

The element has the following contents:

AlloppSpeciesBindings element (exactly one)
AlloppSpeciesNetworkModel element (exactly one)

Example:

<hybPopSizesScaleOperator weight="1.0" scaleFactor="1.0">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp2">
    <apsp idref="apsp8">
    <apsp idref="apsp6">
    <apsp idref="apsp9">
    <geneTrees>
      <starTreeModel idref="starTreeModel3">
      <partitionedTreeModel idref="partitionedTreeModel8">
      <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
      <gtree popfactor="1.0">
        <treeModel idref="treeModel7">
      </gtree>
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel7">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies6">
    <tipPopulations value="1.0">
      <differenceParameter idref="differenceParameter6">
    </tipPopulations>
    <rootPopulations value="1.0">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision5">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <compoundParameter idref="compoundParameter8">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</hybPopSizesScaleOperator>

`<hypermutantAlignment>` element

Converts an alignment so that ‘A’s at specific APOBEC targeted contexts are set to an A/G ambiguity code.

The element takes following attributes:

type is of type String

“The type of APOBEC molecule being modelled”

The element has the following contents:

Alignment element (exactly one)

Example:

<hypermutantAlignment type="hA3F">
  <sequenceSimulator replications="1">
    <newick idref="newick8">
    ERROR!
  </sequenceSimulator>
</hypermutantAlignment>

`<hypermutantErrorModel>` element

This element returns a model that allows for APOBEC-type RNA editing.

The element takes following attributes:

unlinkedRates (optional) is of type Boolean

The element has the following contents:

HypermutantAlignment element (exactly one)
Element named <hypermutationRate>
The hypermutation rate per target site per sequence
Containing:
- Parameter element (exactly one)
Element named <hypermutationIndicators>
A binary indicator of whether the sequence is hypermutated
Containing:
- Parameter element (exactly one)

Example:

<hypermutantErrorModel unlinkedRates="true">
  ERROR!
  <hypermutationRate>
    <vectorSlice idref="vectorSlice2">
  </hypermutationRate>
  <hypermutationIndicators>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView5">
  </hypermutationIndicators>
</hypermutantErrorModel>

`<immutableParameter>` element

An immutable parameter generated from a statistic.

The element has the following contents:

Statistic element (exactly one)

Example:

<immutableParameter>
  <matrixInverse>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView6">
  </matrixInverse>
</immutableParameter>

`<ImportanceNarrowExchange>` element

This element represents a swap operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

weight is of type Double
epsilon (optional) is of type Double

The element has the following contents:

PatternList element (exactly one)
TreeModel element (exactly one)

Example:

<ImportanceNarrowExchange weight="1.0" epsilon="1.0">
  <sequenceSimulator replications="1">
    <tree idref="tree8">
    ERROR!
  </sequenceSimulator>
  <treeModel fixHeights="true" fixTree="true">
    <upgmaTree idref="upgmaTree8">
    <rootHeight>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </nodeHeights>
    <leafHeight taxon="foo">
      <diagonalMatrix idref="diagonalMatrix4">
    </leafHeight>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    </leafHeight>
    <leafHeight taxon="foo">
      <complementParameter idref="complementParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <immutableParameter idref="immutableParameter5">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastMatrixParameter idref="fastMatrixParameter7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastMatrixParameter idref="fastMatrixParameter5">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter10">
    </leafTrait>
  </treeModel>
</ImportanceNarrowExchange>

`<ImportancePruneAndRegraft>` element

This element represents a importance guided prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution.

The element takes following attributes:

weight is of type Double
samples is of type Integer

The element has the following contents:

TreeModel element (exactly one)

Example:

<ImportancePruneAndRegraft weight="1.0" samples="1">
  <starTreeModel>
    <tree idref="tree4">
    <rootHeight>
      <matrixMatrixProduct idref="matrixMatrixProduct4">
    </rootHeight>
    <leafTrait taxon="foo" name="foo">
      <jointParameter idref="jointParameter10">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <matrixMatrixProduct idref="matrixMatrixProduct2">
    </leafTrait>
  </starTreeModel>
</ImportancePruneAndRegraft>

`<ImportanceSubtreeSwap>` element

This element represents a importance guided subtree swap operator. This operator swaps a random subtree with a second subtree guided by an importance distribution.

The element takes following attributes:

weight is of type Double
samples is of type Integer

The element has the following contents:

TreeModel element (exactly one)

Example:

<ImportanceSubtreeSwap weight="1.0" samples="1">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <upgmaTree idref="upgmaTree8">
  </empiricalTreeDistributionModel>
</ImportanceSubtreeSwap>

`<individual>` element

Individual specimen from a species, possibly containing multiple genomes.

The element has the following contents:

Taxon elements (one or more)

Example:

<individual>
  <individual>
    <individual idref="individual6">
    <individual idref="individual5">
    <sp idref="sp9">
  </individual>
  <taxon id="foo"/>
  <sp>
    <apsp idref="apsp2">
    <individual idref="individual1">
    <sp idref="sp10">
  </sp>
  <taxon id="foo"/>
</individual>

`<individualPrior>` element

Calculates the probability of a set of doubles all being drawn from the specified prior distribution

The element takes following attributes:

id is of type String

The element has the following contents:

Element named <distribution>

Containing:
- ParametricDistributionModel element (exactly one)

Example:

<individualPrior id="foo">
  <distribution>
    <exponentialDistributionModel idref="exponentialDistributionModel7">
  </distribution>
</individualPrior>

`<infectionBranchMovementOperator>` element

This operator switches the painting of a random eligible internal node from the painting of one of its children to the painting of the other

The element takes following attributes:

weight is of type Double
resampleInfectionTimes (optional) is of type Boolean

The element has the following contents:

CaseToCaseTreeLikelihood element (exactly one)

Example:

<infectionBranchMovementOperator weight="1.0" resampleInfectionTimes="true">
  <withinCaseCoalescent truncate="true">
    <partitionedTreeModel idref="partitionedTreeModel2">
    <maxFirstInfToRoot>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix4">
    </maxFirstInfToRoot>
    <demographicModel>
      <exponentialSawtooth idref="exponentialSawtooth4">
    </demographicModel>
  </withinCaseCoalescent>
</infectionBranchMovementOperator>

`<inhibitionLikelihood>` element

Provides the likelihood of a continuous trait evolving on a tree by a given diffusion model.

The element has the following contents:

TreeModel element (exactly one)
MatrixParameter element (exactly one)
Element named <precision>

Containing:
- Parameter element (exactly one)

Example:

<inhibitionLikelihood>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <distanceMatrix idref="distanceMatrix5">
  </empiricalTreeDistributionModel>
  <mvPolyaLikelihood>
    <data>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </data>
    <alpha>
      <duplicatedParameter idref="duplicatedParameter6">
    </alpha>
  </mvPolyaLikelihood>
  <precision>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision5">
  </precision>
</inhibitionLikelihood>

`<integer>` element

returns an Integer. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as an Integer.

The element has the following contents:

One of:
- prompt is of type String
  
  “A message displayed to the user when entering a value for this integer”
- Integer element (exactly one)

Example:

<integer prompt="Enter the number of categories:"/>

`<integerParameter>` element

An integer-valued parameter only for staircase bound.

The element takes following attributes:

value (optional) is of type Integer;
dimension (optional) is of type Integer

Example:

<integerParameter value="1 2 4 8" dimension="1"/>

`<integratedFactorModel>` element

null

The element takes following attributes:

traitName is of type String
nugget (optional) is of type Double

The element has the following contents:

Element named <loadings>

Containing:
- MatrixParameterInterface element (exactly one)
Element named <precision>

Containing:
- Parameter element (exactly one)
MultivariateTraitTree element (exactly one)
Element named <traitParameter>

Containing:
- Parameter element (exactly one)
Element named <missingIndicator>

Containing:
- Parameter element (exactly one)

Example:

<integratedFactorModel traitName="foo" nugget="1.0">
  <loadings>
    <matrixParameter idref="matrixParameter6">
  </loadings>
  <precision>
    <jointParameter idref="jointParameter8">
  </precision>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <speciesTree idref="speciesTree2">
    <rootHeight>
      <designMatrix idref="designMatrix4">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundParameter idref="compoundParameter6">
    </nodeHeights>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <diagonalMatrix idref="diagonalMatrix5">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <vectorSlice idref="vectorSlice7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <jointParameter idref="jointParameter1">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter5">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak10">
    </outbreak>
  </partitionedTreeModel>
  <traitParameter>
    <leafTraitParameter idref="leafTraitParameter9">
  </traitParameter>
</integratedFactorModel>

`<integratedMixtureModel>` element

This element represents a finite mixture of likelihood models.

The element takes following attributes:

normalize (optional) is of type Boolean

The element has the following contents:

Likelihood elements ( or more)
Parameter element (exactly one)

Example:

<integratedMixtureModel normalize="true">
  <mulSpeciesTreePrior>
    <model>
      <birthDeathSerialSampling idref="birthDeathSerialSampling7">
    </model>
    <mulTree>
      <mulSpeciesTree idref="mulSpeciesTree2">
    </mulTree>
  </mulSpeciesTreePrior>
  <compoundLikelihood threads="1"/>
  <buildCompoundSymmetricMatrix/>
</integratedMixtureModel>

`<traitGibbsOperator>` element

This element returns a multivariate Gibbs operator on traits for possible all nodes.

The element takes following attributes:

weight is of type Double
onlyInternalNodes (optional) is of type Boolean
onlyTipsWithPriors (optional) is of type Boolean

The element has the following contents:

SampledMultivariateTraitLikelihood element (exactly one)
MultivariateDistributionLikelihood elements (zero or more)
Element named <rootPrior>

Containing:
- MultivariateDistributionLikelihood element (exactly one)
GeoSpatialCollectionModel element (zero or one)

Example:

<traitGibbsOperator weight="1.0" onlyInternalNodes="true" onlyTipsWithPriors="true">
  ERROR!
  <multivariateGammaPrior>
    <meanParameter>
      <vectorSlice idref="vectorSlice10">
    </meanParameter>
    <scaleParameter>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </scaleParameter>
    <data>
      <duplicatedParameter idref="duplicatedParameter6">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter10">
    </data>
  </multivariateGammaPrior>
  <treeTraitNormalDistributionLikelihood>
    <treeTraitNormalDistribution idref="treeTraitNormalDistribution3">
    <data>
      <parameter idref="parameter9">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    </data>
  </treeTraitNormalDistributionLikelihood>
</traitGibbsOperator>

`<intervalLatentLiabilityLikelihood>` element

Provides the likelihood of a latent liability model on multivariate-binary trait data

The element has the following contents:

AbstractMultivariateTraitLikelihood element (exactly one)

The model for the latent random variables
Element named <tipTrait>
The parameter of tip locations from the tree
Containing:
- CompoundParameter element (exactly one)
TreeModel element (exactly one)

The tree model

Example:

<intervalLatentLiabilityLikelihood>
  <inhibitionLikelihood>
    <partitionedTreeModel idref="partitionedTreeModel4">
    <dataFromTreeTips idref="dataFromTreeTips9">
    <precision>
      <designMatrix idref="designMatrix4">
    </precision>
  </inhibitionLikelihood>
  <tipTrait>
    <compoundMatrixParameter idref="compoundMatrixParameter3">
  </tipTrait>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <neighborJoiningTree idref="neighborJoiningTree9">
  </empiricalTreeDistributionModel>
</intervalLatentLiabilityLikelihood>

`<invariantOperator>` element

This element returns a operator that forces the entire model likelihood recomputation

The element takes following attributes:

weight is of type Double
translate (optional) is of type Boolean
rotate (optional) is of type Boolean
checkLikelihood (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)
Likelihood element (zero or one)

Example:

<invariantOperator weight="1.0" translate="true" rotate="true" checkLikelihood="true">
  <differenceParameter>
    <diagonalMatrix idref="diagonalMatrix4">
    <productParameter idref="productParameter8">
  </differenceParameter>
</invariantOperator>

`<inverseGammaDistributionModel>` element

A model of an inverese gamma distribution.

The element has the following contents:

One of:
- Element named <shape>
  
  Containing:
  - Double element (exactly one)
- Element named <shape>
  
  Containing:
  - Parameter element (exactly one)
One of:
- Element named <scale>
  
  Containing:
  - Double element (exactly one)
- Element named <scale>
  
  Containing:
  - Parameter element (exactly one)

Example:

<inverseGammaDistributionModel>
  <shape>
    1.0
  </shape>
  <scale>
    1.0
  </scale>
</inverseGammaDistributionModel>

`<invgammaPrior>` element

Calculates the prior probability of some data under a given inverse gamma distribution.

The element takes following attributes:

shape is of type Double
scale is of type Double
offset (optional) is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<invgammaPrior shape="1.0" scale="1.0" offset="1.0">
  <exponentialStatistic>
    <exponentialStatistic idref="exponentialStatistic1">
  </exponentialStatistic>
  <notStatistic>
    <sumParameter idref="sumParameter9">
  </notStatistic>
  <generalizedSkylinePopSizeStatistic/>
</invgammaPrior>

`<inverseGaussianDistributionModel>` element

Describes a inverse gaussian distribution with a given mean and shape (or standard deviation) that can be used in a distributionLikelihood element

The element takes following attributes:

offset (optional) is of type Double

The element has the following contents:

Element named <mean>

Containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)
Element named <stdev>

Containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)
Element named <shape>

Containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)

Example:

<inverseGaussianDistributionModel offset="1.0">
  <mean>
    1.0
  </mean>
</inverseGaussianDistributionModel>

`<inverseTransform>` element

null

The element has the following contents:

Transform$ParsedTransform element (exactly one)

Example:

<inverseTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform9">
    </outer>
    <inner>
      <transform idref="transform7">
    </inner>
  </composedTransform>
</inverseTransform>

`<invgammaPrior>` element

Calculates the prior probability of some data under a given inverse gamma distribution.

The element takes following attributes:

shape is of type Double
scale is of type Double
offset (optional) is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<invgammaPrior shape="1.0" scale="1.0" offset="1.0">
  <coalescentIntervalStatistic>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood2">
  </coalescentIntervalStatistic>
  <adaptableSizeFastMatrixParameter columns="1" rows="1" maxRowSize="1" maxColumnSize="1" startingValue="1.0" lowerTriangle="true"/>
  <sumParameter>
    <vectorSlice idref="vectorSlice4">
    <matrixParameter idref="matrixParameter1">
  </sumParameter>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <maskedMatrixParameter idref="maskedMatrixParameter10">
  </maskedMatrixParameter>
</invgammaPrior>

`<oneOnXPrior>` element

Calculates the (improper) prior proportional to Prod_i (1/x_i) for the given statistic x.

The element has the following contents:

One of:
- Statistic elements (one or more)
- Element named <data>
  
  Containing:
  - Statistic elements (one or more)

Example:

<oneOnXPrior>
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <inhibitionLikelihood idref="inhibitionLikelihood6">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood7">
  </continuousDiffusionStatistic>
</oneOnXPrior>

`<jitter>` element

This element returns a random walk operator on a given parameter.

The element takes following attributes:

times (optional) is of type Integer
scale (optional) is of type Double

The element has the following contents:

Parameter element (exactly one)

Example:

<jitter times="1" scale="1.0">
  <leafTraitParameter taxon="foo" setBounds="true">
    <treeModel idref="treeModel4">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </leafTraitParameter>
</jitter>

`<sumDerivative>` element

null

The element has the following contents:

GradientWrtParameterProvider elements (one or more)

Example:

<sumDerivative>
  <gradient>
    <cachedPrior idref="cachedPrior7">
  </gradient>
  <sumDerivative>
    <sumDerivative idref="sumDerivative7">
  </sumDerivative>
</sumDerivative>

`<jointOperator>` element

This element represents an arbitrary list of operators; only the first is optimizable

The element takes following attributes:

weight is of type Double
targetAcceptance (optional) is of type Double

The element has the following contents:

SimpleMCMCOperator elements (one or more)

Example:

<jointOperator weight="1.0" targetAcceptance="1.0">
  <MsatFullAncestryImportanceSamplingOperator weight="1.0">
    <leafTraitParameter idref="leafTraitParameter1">
    <microsatelliteSamplerTreeModel idref="microsatelliteSamplerTreeModel5">
    ERROR!
    <argDiscretizedBranchRates idref="argDiscretizedBranchRates9">
  </MsatFullAncestryImportanceSamplingOperator>
  <transmissionExchangeOperatorA weight="1.0" resampleInfectionTimes="true">
    <withinCaseCoalescent idref="withinCaseCoalescent2">
  </transmissionExchangeOperatorA>
  <narrowExchange weight="1.0">
    <treeModel idref="treeModel7">
  </narrowExchange>
  <setOperator set="0.5 1.0" weight="1.0">
    <productParameter idref="productParameter10">
  </setOperator>
</jointOperator>

`<jointParameter>` element

A parameter that synchronises its component parameters.

The element has the following contents:

Parameter elements (one or more)

Example:

<jointParameter>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
  </maskedMatrixParameter>
  <matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    <differenceMatrixParameter idref="differenceMatrixParameter1">
  </matrixParameter>
</jointParameter>

`<knownVarianceNormalPeriodPriorDistribution>` element

Calculates the probability of a set of doubles being drawn from the prior posterior distributionof a normal distribution of unknown mean and known standard deviation sigma

The element takes following attributes:

log (optional) is of type Boolean
id is of type String
mu0 is of type Double
sigma is of type Double
sigma0 is of type Double

Example:

<knownVarianceNormalPeriodPriorDistribution log="true" id="foo" mu0="1.0" sigma="1.0" sigma0="1.0"/>

`<kStateType>` element

Parser for k-state model.

The element takes following attributes:

stateCount is of type Integer
startWith (optional) is of type Integer

Example:

<kStateType stateCount="1" startWith="1"/>

`<laplacePrior>` element

Calculates the prior probability of some data under a given laplace distribution.

The element takes following attributes:

mean is of type Double
scale is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<laplacePrior mean="1.0" scale="1.0">
  <parsimonyStatistic name="foo">
    <partitionedTreeModel idref="partitionedTreeModel5">
    <state>
      <taxa idref="taxa3">
    </state>
  </parsimonyStatistic>
  <differenceStatistic absolute="true">
    <alloppNumHybsStatistic idref="alloppNumHybsStatistic2">
    <mvPolyaLikelihood idref="mvPolyaLikelihood1">
  </differenceStatistic>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <dataFromTreeTips idref="dataFromTreeTips5">
  </maskedMatrixParameter>
</laplacePrior>

`<latentFactorModel>` element

Sets up a latent factor model, with starting guesses for the loadings and factor matrices as well as the data for the factor analysis

The element takes following attributes:

factorNumber is of type Integer
scaleData (optional) is of type Boolean
computeResidualsForDiscrete (optional) is of type Boolean
recomputeFactors (optional) is of type Boolean
recomputeResiduals (optional) is of type Boolean
recomputeLoadings (optional) is of type Boolean

The element has the following contents:

Element named <data>

Containing:
- MatrixParameterInterface element (exactly one)
Element named <factors>

Containing:
- CompoundParameter element (exactly one)
Element named <loadings>

Containing:
- MatrixParameterInterface element (exactly one)
Element named <rowPrecision>

Containing:
- DiagonalMatrix element (exactly one)
Element named <columnPrecision>

Containing:
- DiagonalMatrix element (exactly one)
Element named <continuous>

Containing:
- Parameter element (exactly one)
Element named <missingIndicator>

Containing:
- Parameter element (exactly one)

Example:

<latentFactorModel factorNumber="1" scaleData="true" computeResidualsForDiscrete="true" recomputeFactors="true" recomputeResiduals="true" recomputeLoadings="true">
  <data>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter6">
  </data>
  <factors>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </factors>
  <loadings>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter2">
  </loadings>
  <rowPrecision>
    ERROR!
  </rowPrecision>
  <columnPrecision>
    ERROR!
  </columnPrecision>
</latentFactorModel>

`<latentLiabilityGibbsOperator>` element

This element returns a gibbs sampler on tip latent trais for latent liability model.

The element takes following attributes:

weight is of type Double

The element has the following contents:

FullyConjugateMultivariateTraitLikelihood element (exactly one)

The model for the latent random variables
LatentTruncation element (exactly one)

The model that links latent and observed variables
CompoundParameter element (exactly one)

The parameter of tip locations from the tree

Example:

<latentLiabilityGibbsOperator weight="1.0">
  ERROR!
  <latentLiabilityLikelihood>
    <inhibitionLikelihood idref="inhibitionLikelihood4">
    <tipTrait>
      <dataFromTreeTips idref="dataFromTreeTips8">
    </tipTrait>
    <maskedPatterns idref="maskedPatterns5">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
  </latentLiabilityLikelihood>
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    <generalDataType idref="generalDataType6">
  </originDestinationDesignMatrix>
</latentLiabilityGibbsOperator>

`<latentLiabilityLikelihood>` element

Provides the likelihood of a latent liability model on multivariate-binary trait data

The element has the following contents:

AbstractMultivariateTraitLikelihood element (exactly one)

The model for the latent random variables
Element named <tipTrait>
The parameter of tip locations from the tree
Containing:
- CompoundParameter element (exactly one)
PatternList element (exactly one)

The binary tip data
TreeModel element (exactly one)

The tree model

Example:

<latentLiabilityLikelihood>
  <inhibitionLikelihood>
    <starTreeModel idref="starTreeModel8">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix9">
    <precision>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    </precision>
  </inhibitionLikelihood>
  <tipTrait>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix2">
  </tipTrait>
  <constantPatterns>
    <patternSubSet idref="patternSubSet10">
    <counts>
      <matrixMatrixProduct idref="matrixMatrixProduct9">
    </counts>
  </constantPatterns>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <upgmaTree idref="upgmaTree2">
    <rootHeight>
      <matrixVectorProductParameter idref="matrixVectorProductParameter6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice10">
    </nodeHeights>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <diagonalMatrix idref="diagonalMatrix7">
    </leafHeight>
    <leafHeight taxon="foo">
      <immutableParameter idref="immutableParameter9">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix3">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <jointParameter idref="jointParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter7">
    </nodeRates>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak10">
    </outbreak>
  </partitionedTreeModel>
</latentLiabilityLikelihood>

`<latentStateBranchRateModel>` element

This element provides a model with a latent state where no evolution occurs but condition on being non-latent at the nodes.

The element has the following contents:

BranchRateModel element (exactly one)

A branch rate model to provide the rates for the non-latent state
TreeModel element (exactly one)

The tree on which this will operate
CountableBranchCategoryProvider element (zero or one)
Element named <latentTransitionRate>
A parameter which gives the instantaneous rate of switching to and from the latent state
Containing:
- Parameter element (exactly one)
Element named <latentTransitionFrequency>
A parameter which gives the rate bias of switching to and from the latent state
Containing:
- Parameter element (exactly one)
Element named <latentStateProportions>
The proportion of each branch which is spend in a latent state
Containing:
- Parameter element (exactly one)

Example:

<latentStateBranchRateModel>
  <continuousBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0">
    <treeModel idref="treeModel2">
    <distribution>
      <poissonDistributionModel idref="poissonDistributionModel9">
    </distribution>
    <rateCategoryQuantiles>
      <matrixParameter idref="matrixParameter6">
    </rateCategoryQuantiles>
  </continuousBranchRates>
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork1">
    <rootHeight>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <fastMatrixParameter idref="fastMatrixParameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
    </nodeHeights>
    <leafHeight taxon="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </leafHeight>
    <leafHeight taxon="foo">
      <complementParameter idref="complementParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <parameter idref="parameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter7">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter4">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter10">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix7">
    </leafTrait>
  </treeModel>
  <latentTransitionRate>
    <dataFromTreeTips idref="dataFromTreeTips10">
  </latentTransitionRate>
  <latentTransitionFrequency>
    <differenceParameter idref="differenceParameter2">
  </latentTransitionFrequency>
</latentStateBranchRateModel>

`<leafTraitParameter>` element

Parses the leaf trait parameter out of the compound parameter of an integrated trait likelihood

The element takes following attributes:

taxon is of type String
setBounds (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)
CompoundParameter element (exactly one)

Example:

<leafTraitParameter taxon="foo" setBounds="true">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <partitionedTreeModel idref="partitionedTreeModel3">
    <rootHeight>
      <matrixParameter idref="matrixParameter10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues6">
    </nodeHeights>
    <leafHeight taxon="foo">
      <matrixMatrixProduct idref="matrixMatrixProduct6">
    </leafHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </leafHeight>
    <leafHeight taxon="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </leafHeight>
    <leafHeight taxon="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter1">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <copyParameterValues idref="copyParameterValues4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <complementParameter idref="complementParameter6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter3">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <vectorSlice idref="vectorSlice3">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <sumParameter idref="sumParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter3">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak6">
    </outbreak>
  </partitionedTreeModel>
  <elementWiseMatrixMultiplicationParameter/>
</leafTraitParameter>

`<lewisMk>` element

A parser for Lewis’s Mk model

The element takes following attributes:

totalOrder (optional) is of type Boolean

The element has the following contents:

Element named <frequencies>

Containing:
- FrequencyModel element (exactly one)
Element named <order>

Containing:
- state is of type String
- adjacentTo is of type String

Example:

<lewisMk totalOrder="true">
  <frequencies>
    <frequencyModel idref="frequencyModel5">
  </frequencies>
  <order state="foo" adjacentTo="foo"/>
  <order state="foo" adjacentTo="foo"/>
  <order state="foo" adjacentTo="foo"/>
  <order state="foo" adjacentTo="foo"/>
</lewisMk>

`<compoundLikelihood>` element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

threads (optional) is of type Integer

The element has the following contents:

Likelihood elements ( or more)

Example:

<compoundLikelihood threads="1">
  <modelSpecificPseudoPrior/>
  <pathLikelihood>
    <source>
      <modelSpecificPseudoPrior idref="modelSpecificPseudoPrior3">
    </source>
    <destination>
      <multivariateInverseWishartPrior idref="multivariateInverseWishartPrior2">
    </destination>
  </pathLikelihood>
  <logTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
    <treeLengthStatistic idref="treeLengthStatistic8">
    <sumParameter idref="sumParameter6">
    <copyParameterValues idref="copyParameterValues2">
  </logTransformedNormalReferencePrior>
  <compoundLikelihood threads="1">
    <twoPartDistribution idref="twoPartDistribution4">
  </compoundLikelihood>
</compoundLikelihood>

`<likelihoodProfile>` element

This element represents a tool to profile a likelihood surface

The element takes following attributes:

lower is of type Double;
upper is of type Double;
dim (optional) is of type Integer
points (optional) is of type Integer

The element has the following contents:

Likelihood element (exactly one)
Parameter element (exactly one)
Element named <expectation>

Containing:
- samples is of type Integer
- RandomGenerator element (exactly one)
- Parameter element (exactly one)

Example:

<likelihoodProfile lower="0.5 1.0" upper="0.5 1.0" dim="1" points="1">
  <uniformNodeHeightPrior analytic="true" maxRootHeight="1.0" mcSampleSize="1" marginal="true" approximate="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4">
  </uniformNodeHeightPrior>
  <differenceMatrixParameter/>
</likelihoodProfile>

`<lineageCountStatistic>` element

The element has the following contents:

OldAbstractCoalescentLikelihood element (exactly one)

Example:

<lineageCountStatistic>
  <generalizedSkyLineLikelihood linear="true">
    <populationSizes>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </populationSizes>
    <groupSizes>
      <matrixParameter idref="matrixParameter5">
    </groupSizes>
    <populationTree>
      <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
    </populationTree>
  </generalizedSkyLineLikelihood>
</lineageCountStatistic>

`<lineageSpecificBranchModel>` element

This element provides a branch model which has branches assigned to specific substitution models.These assignments can then be changed in course of MCMC.

The element has the following contents:

TreeModel element (exactly one)
FrequencyModel element (exactly one)
Element named <models>

Containing:
- AbstractModel elements (one or more)
Element named <categories>

Containing:
- Parameter element (exactly one)

Example:

<lineageSpecificBranchModel>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <alignment idref="alignment9">
  </empiricalTreeDistributionModel>
  <frequencyModel composition="3x4" normalize="true" compress="true" dataType="codon-universal">
    <frequencies>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    </frequencies>
  </frequencyModel>
  <models>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood6">
    <uniformNodeHeightPrior idref="uniformNodeHeightPrior2">
  </models>
  <categories>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
  </categories>
</lineageSpecificBranchModel>

`<localClockModel>` element

This element returns a branch rate model that adds a delta to each terminal branch length.

The element has the following contents:

TreeModel element (exactly one)
Element named <rate>
The molecular evolutionary rate parameter
Containing:
- Parameter element (exactly one)
Element named <externalBranches>

Containing:
- relative (optional) is of type Boolean
- Taxa element (exactly one)
  
  A local clock that will be applied only to the external branches for these taxa
- Parameter element (exactly one)
  
  The rate parameter
Element named <clade>

Containing:
- relative (optional) is of type Boolean
- includeStem (optional) is of type Boolean
  
  “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
- stemProportion (optional) is of type Double
  
  “proportion of stem to include in clade rate (default 0).”
- excludeClade (optional) is of type Boolean
  
  “determines whether to exclude actual branches of the clade from the siteModel (default false).”
- Taxa element (exactly one)
  
  A set of taxa which defines a clade to apply a different site model to
- Parameter element (exactly one)
  
  The rate parameter
Element named <trunk>

Containing:
- relative (optional) is of type Boolean
- Taxa element (exactly one)
  
  A local clock that will be applied only to the ‘trunk’ branches defined by these taxa
- Parameter element (exactly one)
  
  The rate parameter
- Element named <index>
  The trunk taxon index
  Containing:
  - Parameter element (exactly one)

Example:

<localClockModel>
  <starTreeModel>
    <treeModel idref="treeModel10">
    <rootHeight>
      <fastMatrixParameter idref="fastMatrixParameter7">
    </rootHeight>
    <leafHeight taxon="foo">
      <maskedParameter idref="maskedParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter9">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <parameter idref="parameter6">
    </leafTrait>
  </starTreeModel>
  <rate>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
  </rate>
  <clade relative="true" includeStem="true" stemProportion="1.0" excludeClade="true">
    <taxa idref="taxa3">
    <dataFromTreeTips idref="dataFromTreeTips4">
  </clade>
  <trunk relative="true">
    <taxa idref="taxa1">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter8">
  </trunk>
  <trunk relative="true">
    <taxa idref="taxa6">
    <differenceMatrixParameter idref="differenceMatrixParameter5">
  </trunk>
</localClockModel>

`<location>` element

Specifies a location with an optional longitude and latitude

The element takes following attributes:

description (optional) is of type String

“A description of this location”
longitude (optional) is of type String

“The longitude in degrees, minutes, seconds or decimal degrees”
latitude (optional) is of type String

“The latitude in degrees, minutes, seconds or decimal degrees”

Example:

<location description="foo" longitude="foo" latitude="foo"/>

`<log>` element

Logs one or more items at a given frequency to the screen or to a file

The element takes following attributes:

logEvery is of type Integer
overwrite (optional) is of type Boolean
fileName (optional) is of type String

“The name of the file to send log output to. If no file name is specified then log is sent to standard output”
title (optional) is of type String

“The title of the log”
header (optional) is of type String

“The subtitle of the log”

The element has the following contents:

At least one of:
- Columns elements (one or more)
- Loggable elements (one or more)
- Object elements (one or more)

Example:

<log logEvery="1" overwrite="true" fileName="foo" title="foo" header="foo">
  <biasedMultivariateDiffusionModel>
    <precisionMatrix>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </precisionMatrix>
    <biasParameter>
      <designMatrix idref="designMatrix9">
    </biasParameter>
  </biasedMultivariateDiffusionModel>
  <gmrfBivariateCurveAnalysis fileName1="foo" fileName2="foo" endTime="foo" burnIn="1"/>
  <uniformPartitionLikelihood>
    <argTreeModel idref="argTreeModel6">
  </uniformPartitionLikelihood>
</log>

`<logAllTraits>` element

null

The element has the following contents:

TreeModel element (exactly one)

The tree which is to be logged

Example:

<logAllTraits>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <alignment idref="alignment4">
  </empiricalTreeDistributionModel>
</logAllTraits>

`<logArg>` element

Logs an ARG to a file

The element takes following attributes:

logEvery is of type Integer
format is of type String

“The type logger’s output type”
fileName (optional) is of type String

“The name of the file to send log output to. If no file name is specified then log is sent to standard output”
title (optional) is of type String

“The title of the log”

The element has the following contents:

ARGModel element (exactly one)

The ARG which is to be logged

Example:

<!-- The logArg element takes an argModel to be logged -->
<logArg logEvery="100" fileName="log.args">
	<argModel idref="treeModel1"/>
</logArg>

`<logArgTree>` element

Logs a tree to a file

The element takes following attributes:

logEvery is of type Integer
partition is of type Integer
fileName (optional) is of type String

“The name of the file to send log output to. If no file name is specified then log is sent to standard output”
title (optional) is of type String

“The title of the log”
nexusFormat (optional) is of type Boolean

“Whether to use the NEXUS format for the tree log”
branchLengths (optional) is of type String

“What units should the branch lengths be in”

The element has the following contents:

ARGModel element (exactly one)

The ARG which is to be logged
BranchRateModel element (zero or one)
ColourSamplerModel element (zero or one)
Likelihood element (zero or one)

Example:

<!-- The logArgTree element takes an argTreeModel to be logged -->
<logArgTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logArgTree>

`<logarithmStatistic>` element

This element returns a statistic that is the element-wise natural logarithm of the child statistic.

The element takes following attributes:

base (optional) is of type Double

“An optional base for the logarithm (default is the natural logarithm, base e)”

The element has the following contents:

Statistic element (exactly one)

Example:

<logarithmStatistic base="1.0">
  <meanStatistic>
    <varianceStatistic idref="varianceStatistic9">
    <popGraph idref="popGraph8">
    <coalescentEventsStatistic idref="coalescentEventsStatistic7">
  </meanStatistic>
</logarithmStatistic>

`<logarithmStatistic>` element

This element returns a statistic that is the element-wise natural logarithm of the child statistic.

The element takes following attributes:

base (optional) is of type Double

“An optional base for the logarithm (default is the natural logarithm, base e)”

The element has the following contents:

Statistic element (exactly one)

Example:

<logarithmStatistic base="1.0">
  <productParameter>
    <jointParameter idref="jointParameter5">
    <productParameter idref="productParameter6">
  </productParameter>
</logarithmStatistic>

`<logFileTrace>` element

reconstruct population graph from variable dimension run.

The element takes following attributes:

fileName is of type String

“trace log.”
burnIn (optional) is of type Integer

“The number of states (not sampled states, but actual states) that are discarded from the beginning of the trace before doing the analysis”

Example:

<logFileTrace fileName="foo" burnIn="1"/>

`<loggableStatistic>` element

Allows you to choose specific dimensions of a given statistic

The element has the following contents:

Loggable element (exactly one)

Example:

<loggableStatistic>
  <jointParameter>
    <sumParameter idref="sumParameter10">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix4">
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix5">
    <duplicatedParameter idref="duplicatedParameter9">
  </jointParameter>
</loggableStatistic>

`<logisticGrowth>` element

Logistic growth demographic model.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>
This parameter represents the population size at time 0 (the time of the last tip of the tree)
Containing:
- Parameter element (exactly one)
One of:
- Element named <growthRate>
  This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.
  Containing:
  - Parameter element (exactly one)
- Element named <doublingTime>
  This parameter determines the doubling time at peak growth rate.
  Containing:
  - Parameter element (exactly one)
Element named <t50>
This parameter represents the time in the past when the population was half of that which it isat time zero (not half it’s carrying capacity). It is therefore a positive number with the same units as divergence times. A scale operator is recommended with a starting value near zero. A lower bound of zero should be employed and an upper bound is recommended.
Containing:
- Parameter element (exactly one)

Example:

<logisticGrowth units="mutations">
  <populationSize>
    <fastMatrixParameter idref="fastMatrixParameter8">
  </populationSize>
  <growthRate>
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix4">
  </growthRate>
  <t50>
    <mvPolyaLikelihood idref="mvPolyaLikelihood10">
  </t50>
</logisticGrowth>

`<logitTransformedNormalReferencePrior>` element

Calculates the reference prior probability of some data under logit transformed normal distribution.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
burnin is of type Integer
dimension (optional) is of type Integer
upperLimit (optional) is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<logitTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1" dimension="1" upperLimit="1.0">
  <partitionStatistic/>
</logitTransformedNormalReferencePrior>

`<logitTransformedNormalReferencePrior>` element

Calculates the reference prior probability of some data under logit transformed normal distribution.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
burnin is of type Integer
dimension (optional) is of type Integer
upperLimit (optional) is of type Double

The element has the following contents:

Statistic elements (one or more)

Example:

<logitTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1" dimension="1" upperLimit="1.0">
  <differenceStatistic absolute="true">
    <coalescentIntervalStatistic idref="coalescentIntervalStatistic3">
    <sumStatistic idref="sumStatistic8">
  </differenceStatistic>
  <logarithmStatistic base="1.0">
    <sumStatistic idref="sumStatistic3">
  </logarithmStatistic>
  <logarithmStatistic base="1.0">
    <treeMetricStatistic idref="treeMetricStatistic3">
  </logarithmStatistic>
  <lineageCountStatistic>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood5">
  </lineageCountStatistic>
</logitTransformedNormalReferencePrior>

`<logML>` element

Logs one or more items every time the given likelihood improves

The element takes following attributes:

logEvery (optional) is of type Integer

The element has the following contents:

Element named <ml>

Containing:
- Likelihood element (exactly one)
At least one of:
- Columns elements (one or more)
- Loggable elements (one or more)

Example:

<logML logEvery="1">
  <ml>
    <glmSubstitutionModel idref="glmSubstitutionModel10">
  </ml>
  <column label="foo" sf="1" dp="1" width="1" format="foo">
    <cNcSTodNdSPerSiteAnalysis idref="cNcSTodNdSPerSiteAnalysis10">
    <intervalLatentLiabilityLikelihood idref="intervalLatentLiabilityLikelihood6">
    <antigenicDriftPrior idref="antigenicDriftPrior6">
    <argRatePrior idref="argRatePrior4">
  </column>
  <column label="foo" sf="1" dp="1" width="1" format="foo">
    <operators idref="operators1">
    <complexSubstitutionModel idref="complexSubstitutionModel1">
    <cNcSTodNdSPerSiteAnalysis idref="cNcSTodNdSPerSiteAnalysis2">
  </column>
</logML>

`<logNormalDistributionModel>` element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element

The element takes following attributes:

meanInRealSpace (optional) is of type Boolean
stdevInRealSpace (optional) is of type Boolean
offset (optional) is of type Double

The element has the following contents:

Element named <mean>

Containing:
- One of:
  - Parameter element (exactly one)
  - Double element (exactly one)
One of:
- Element named <stdev>
  
  Containing:
  - One of:
    - Parameter element (exactly one)
    - Double element (exactly one)
- Element named <precision>
  
  Containing:
  - One of:
    - Parameter element (exactly one)
    - Double element (exactly one)

Example:

<logNormalDistributionModel meanInRealSpace="true" stdevInRealSpace="true" offset="1.0">
  <mean>
    1.0
  </mean>
  <precision>
    <maskedMatrixParameter idref="maskedMatrixParameter2">
  </precision>
</logNormalDistributionModel>

`<logNormalPrior>` element

Calculates the prior probability of some data under a given lognormal distribution.

The element takes following attributes:

mean is of type Double
stdev is of type Double
offset (optional) is of type Double
meanInRealSpace (optional) is of type Boolean

The element has the following contents:

Statistic elements (one or more)

Example:

<logNormalPrior mean="1.0" stdev="1.0" offset="1.0" meanInRealSpace="true">
  <compoundParameter>
    <leafTraitParameter idref="leafTraitParameter4">
    <differenceMatrixParameter idref="differenceMatrixParameter5">
    <immutableParameter idref="immutableParameter4">
    <sumParameter idref="sumParameter4">
  </compoundParameter>
  <externalLengthStatistic name="foo">
    <treeModel idref="treeModel2">
    <taxa idref="taxa1">
  </externalLengthStatistic>
  <statistic name="foo">
    <hkyModel idref="hkyModel5">
  </statistic>
</logNormalPrior>

`<logPartitionedTree>` element

Logs a partitioned tree (phylogenetic tree and transmission tree)

The element takes following attributes:

logEvery (optional) is of type Integer
overwrite (optional) is of type Boolean
fileName (optional) is of type String

“The name of the file to send log output to. If no file name is specified then log is sent to standard output”
title (optional) is of type String

“The title of the log”
nexusFormat (optional) is of type Boolean

“Whether to use the NEXUS format for the tree log”
sortTranslationTable (optional) is of type Boolean

“Whether the translation table is sorted.”
branchLengths (optional) is of type String

“What units should the branch lengths be in”
traitFilter (optional) is of type String
mapNamesToNumbers (optional) is of type Boolean
dp (optional) is of type Integer

The element has the following contents:

Tree element (exactly one)

The tree which is to be logged
Element named <trait>

Containing:
- name is of type String
  
  “The name of the trait”
- tag (optional) is of type String
  
  “The label of the trait to be used in the tree”
- TreeAttributeProvider element (exactly one)
  
  The trait provider
Likelihood element (zero or one)
Loggable elements (zero or more)
TreeAttributeProvider elements (zero or more)
TreeTraitProvider elements (zero or more)
TreeLogger$LogUpon element (zero or one)
CaseToCaseTreeLikelihood element (exactly one)

Example:

<!-- The logPartitionedTree element takes a treeModel to be logged -->
<logPartitionedTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logPartitionedTree>

`<logRandomWalkOperator>` element

This element returns a scale operator on a given parameter.

The element takes following attributes:

window is of type Double
weight is of type Double
autoOptimize (optional) is of type Boolean
scaleAll (optional) is of type Boolean
scaleAllIndependently (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)

Example:

<logRandomWalkOperator window="1.0" weight="1.0" autoOptimize="true" scaleAll="true" scaleAllIndependently="true">
  <fastMatrixParameter rows="1" columns="1"/>
</logRandomWalkOperator>

`<logTransformedNormalReferencePrior>` element

Calculates the reference prior probability of some data under log transformed normal distribution.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
burnin is of type Integer

The element has the following contents:

Statistic elements (one or more)

Example:

<logTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <tmrcaStatistic name="foo" absolute="true" includeStem="true">
    <newick idref="newick2">
  </tmrcaStatistic>
  <test name="foo" greaterThan="1.0">
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser7">
  </test>
</logTransformedNormalReferencePrior>

`<logTransformedNormalReferencePrior>` element

Calculates the reference prior probability of some data under log transformed normal distribution.

The element takes following attributes:

fileName is of type String
parameterColumn is of type String
burnin is of type Integer

The element has the following contents:

Statistic elements (one or more)

Example:

<logTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <logarithmStatistic base="1.0">
    <differenceParameter idref="differenceParameter8">
  </logarithmStatistic>
  <lineageCountStatistic>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood8">
  </lineageCountStatistic>
  <nodeHeightsStatistic name="foo">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
  </nodeHeightsStatistic>
</logTransformedNormalReferencePrior>

`<logTree>` element

Logs a tree to a file

The element takes following attributes:

logEvery (optional) is of type Integer
overwrite (optional) is of type Boolean
fileName (optional) is of type String

“The name of the file to send log output to. If no file name is specified then log is sent to standard output”
title (optional) is of type String

“The title of the log”
nexusFormat (optional) is of type Boolean

“Whether to use the NEXUS format for the tree log”
sortTranslationTable (optional) is of type Boolean

“Whether the translation table is sorted.”
branchLengths (optional) is of type String

“What units should the branch lengths be in”
traitFilter (optional) is of type String
mapNamesToNumbers (optional) is of type Boolean
dp (optional) is of type Integer

The element has the following contents:

Tree element (exactly one)

The tree which is to be logged
Element named <trait>

Containing:
- name is of type String
  
  “The name of the trait”
- tag (optional) is of type String
  
  “The label of the trait to be used in the tree”
- TreeAttributeProvider element (exactly one)
  
  The trait provider
Likelihood element (zero or one)
Loggable elements (zero or more)
TreeAttributeProvider elements (zero or more)
TreeTraitProvider elements (zero or more)
TreeLogger$LogUpon element (zero or one)

Example:

<!-- The logTree element takes a treeModel to be logged -->
<logTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logTree>

`<marginalLikelihoodAnalysis>` element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

fileName is of type String

“The traceName of a BEAST log file (can not include trees, which should be logged separately”
burnIn (optional) is of type Integer

The element has the following contents:

Element named <likelihoodColumn>

Containing:
- name is of type String
  
  “The column name”

Example:

<marginalLikelihoodAnalysis fileName="foo" burnIn="1">
  <likelihoodColumn name="foo"/>
</marginalLikelihoodAnalysis>

`<marginalLikelihoodEstimator>` element

This element returns an MCMC chain and runs the chain as a side effect.

The element takes following attributes:

chainLength is of type Integer
pathSteps (optional) is of type Integer
burnin (optional) is of type Integer
prerun (optional) is of type Integer
linear (optional) is of type Boolean
lacing (optional) is of type Boolean
spawn (optional) is of type Boolean
printOperatorAnalysis (optional) is of type Boolean
pathScheme (optional) is of type String
fixedValues (optional) is of type Double;
alpha (optional) is of type Double
beta (optional) is of type Double

The element has the following contents:

Element named <samplers>

Containing:
- MCMC elements (one or more)
PathLikelihood element (exactly one)
MCLogger elements (one or more)

Example:

<marginalLikelihoodEstimator chainLength="1" pathSteps="1" burnin="1" prerun="1" linear="true" lacing="true" spawn="true" printOperatorAnalysis="true" pathScheme="foo" fixedValues="0.5 1.0" alpha="1.0" beta="1.0">
  <samplers>
    <mcmc idref="mcmc2">
  </samplers>
  ERROR!
  <logPartitionedTree logEvery="1" overwrite="true" fileName="foo" title="foo" nexusFormat="true" sortTranslationTable="true" branchLengths="time" traitFilter="foo" mapNamesToNumbers="true" dp="1">
    <speciesTree idref="speciesTree3">
    <trait name="foo" tag="foo">
      <biasedMultivariateDiffusionModel idref="biasedMultivariateDiffusionModel5">
    </trait>
    <trait name="foo" tag="foo">
      <bifractionalDiffusionModel idref="bifractionalDiffusionModel9">
    </trait>
    <productStatistic idref="productStatistic1">
    <transmissionLikelihood idref="transmissionLikelihood5">
    <matrixMatrixProduct idref="matrixMatrixProduct1">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood6">
    <speciesTree idref="speciesTree9">
    <withinCaseCoalescent idref="withinCaseCoalescent4">
  </logPartitionedTree>
</marginalLikelihoodEstimator>

`<markovJumpsTreeLikelihood>` element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

useAmbiguities (optional) is of type Boolean
stateTagName (optional) is of type String
jumpTagName (optional) is of type String
scaleRewardsByTime (optional) is of type Boolean
useUniformization (optional) is of type Boolean
reportUnconditionedValues (optional) is of type Boolean
numberOfSimulants (optional) is of type Integer
saveCompleteHistory (optional) is of type Boolean
logCompleteHistory (optional) is of type Boolean
compactHistory (optional) is of type Boolean
scalingScheme (optional) is of type String

The element has the following contents:

Element named <partialsRestriction>

Containing:
- TaxonList element (exactly one)
- Parameter element (exactly one)
PatternList element (exactly one)
TreeModel element (exactly one)
GammaSiteRateModel element (exactly one)
BranchModel element (zero or one)
SubstitutionModel element (zero or one)
BranchRateModel element (zero or one)
Parameter elements (zero or more)
Element named <counts>

Containing:
- Parameter elements (zero or more)
Element named <rewards>

Containing:
- Parameter elements (zero or more)
FrequencyModel element (zero or one)

Example:

<markovJumpsTreeLikelihood useAmbiguities="true" stateTagName="foo" jumpTagName="foo" scaleRewardsByTime="true" useUniformization="true" reportUnconditionedValues="true" numberOfSimulants="1" saveCompleteHistory="true" logCompleteHistory="true" compactHistory="true" scalingScheme="foo">
  <constantPatterns>
    <constantPatterns idref="constantPatterns5">
    <counts>
      <copyParameterValues idref="copyParameterValues8">
    </counts>
  </constantPatterns>
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork5">
    <rootHeight>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <complementParameter idref="complementParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter10">
    </nodeHeights>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix5">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <diagonalMatrix idref="diagonalMatrix4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <differenceMatrixParameter idref="differenceMatrixParameter1">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixParameter idref="matrixParameter5">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues10">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues5">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <dataFromTreeTips idref="dataFromTreeTips9">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <parameter idref="parameter2">
    </leafTrait>
  </treeModel>
  <siteModel>
    <mutationRate>
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </mutationRate>
  </siteModel>
  <blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true"/>
</markovJumpsTreeLikelihood>

`<markovModulatedSubstitutionModel>` element

This element represents the a Markov-modulated substitution model.

The element takes following attributes:

dataType is of type String
geometricRates (optional) is of type Boolean
renormalize (optional) is of type Boolean

The element has the following contents:

Element named <switchingRates>

Containing:
- Parameter element (exactly one)
SubstitutionModel elements (one or more)
Element named <rateScalar>

Containing:
- Parameter element (exactly one)
SiteRateModel element (zero or one)

Example:

<markovModulatedSubstitutionModel dataType="foo" geometricRates="true" renormalize="true">
  <switchingRates>
    <sumParameter idref="sumParameter7">
  </switchingRates>
  <lewisMk totalOrder="true">
    <frequencies>
      <frequencyModel idref="frequencyModel9">
    </frequencies>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
  </lewisMk>
  <hkyModel>
    <frequencies>
      <frequencyModel idref="frequencyModel1">
    </frequencies>
    <kappa>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter8">
    </kappa>
  </hkyModel>
  <mutationDeathModel>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    <extendedDataType idref="extendedDataType8">
  </mutationDeathModel>
  <mutationDeathModel>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
    <extendedDataType idref="extendedDataType6">
  </mutationDeathModel>
</markovModulatedSubstitutionModel>

`<markovModulatedYangCodonModel>` element

This element represents the a Markov-modulated Yang model of codon evolution.

The element takes following attributes:

dataType is of type String
geneticCode is of type String
diagonalization is of type String

The element has the following contents:

Element named <omega>

Containing:
- Parameter element (exactly one)
Element named <kappa>

Containing:
- Parameter element (exactly one)
Element named <switchingRates>

Containing:
- Parameter element (exactly one)
FrequencyModel element (exactly one)

Example:

<markovModulatedYangCodonModel dataType="foo" geneticCode="foo" diagonalization="foo">
  <omega>
    <compoundParameter idref="compoundParameter8">
  </omega>
  <kappa>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
  </kappa>
  <switchingRates>
    <dataFromTreeTips idref="dataFromTreeTips3">
  </switchingRates>
  <frequencyModel composition="3x4" normalize="true" compress="true">
    <extendedDataType idref="extendedDataType2">
    <frequencies>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
    </frequencies>
  </frequencyModel>
</markovModulatedYangCodonModel>

`<markovRandomFieldMatrix>` element

A MRF matrix parameter constructed from its diagonals and first-order off diagonal.

The element takes following attributes:

asCorrelation (optional) is of type Boolean
dim is of type Integer

The element has the following contents:

Element named <diagonal>

Containing:
- Parameter element (exactly one)
- Transform$ParsedTransform element (zero or one)
Element named <offDiagonal>

Containing:
- Parameter element (exactly one)
- Transform$ParsedTransform element (zero or one)
Element named <nugget>

Containing:
- Parameter element (exactly one)

Example:

<markovRandomFieldMatrix asCorrelation="true" dim="1">
  <diagonal>
    <maskedParameter idref="maskedParameter1">
  </diagonal>
  <offDiagonal>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
  </offDiagonal>
  <nugget>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter3">
  </nugget>
</markovRandomFieldMatrix>

`<maskedGradient>` element

null

The element has the following contents:

GradientWrtParameterProvider element (exactly one)
Element named <mask>

Containing:
- Parameter element (exactly one)

Example:

<maskedGradient>
  <appendedPotentialDerivative>
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood5">
    <sumDerivative idref="sumDerivative5">
  </appendedPotentialDerivative>
  <mask>
    <duplicatedParameter idref="duplicatedParameter9">
  </mask>
</maskedGradient>

`<maskedMatrixParameter>` element

A masked matrix parameter.

The element takes following attributes:

complement (optional) is of type Boolean
from (optional) is of type Integer
to (optional) is of type Integer
every (optional) is of type Integer

The element has the following contents:

MatrixParameter element (exactly one)
Element named <mask>

Containing:
- Parameter element (exactly one)

Example:

<maskedMatrixParameter complement="true" from="1" to="1" every="1">
  <markovRandomFieldMatrix asCorrelation="true" dim="1">
    <diagonal>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter6">
    </diagonal>
    <offDiagonal>
      <complementParameter idref="complementParameter3">
    </offDiagonal>
    <nugget>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix5">
    </nugget>
  </markovRandomFieldMatrix>
</maskedMatrixParameter>

`<maskedParameter>` element

A masked parameter.

The element takes following attributes:

complement (optional) is of type Boolean
build (optional) is of type Boolean
from (optional) is of type Integer
to (optional) is of type Integer
every (optional) is of type Integer

The element has the following contents:

Parameter element (exactly one)
Element named <mask>

Containing:
- Parameter element (exactly one)

Example:

<maskedParameter complement="true" build="true" from="1" to="1" every="1">
  <matrixMatrixProduct>
    <left>
      <diagonalMatrix idref="diagonalMatrix6">
    </left>
    <right>
      <matrixParameter idref="matrixParameter2">
    </right>
  </matrixMatrixProduct>
</maskedParameter>

`<maskedPatterns>` element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element takes following attributes:

negative (optional) is of type Boolean

The element has the following contents:

SiteList element (exactly one)
Element named <mask>
A parameter of 1s and 0s that represent included and excluded sites
Containing:
- String element (exactly one)

Example:

<maskedPatterns negative="true">
  <hypermutantAlignment type="hA3F">
    <alignment idref="alignment10">
  </hypermutantAlignment>
  <mask>
    foo
  </mask>
</maskedPatterns>

`<matrixInverse>` element

This element returns a statistic that is the matrix inverse of the child statistic.

The element has the following contents:

MatrixParameter element (exactly one)

Example:

<matrixInverse>
  <diagonalMatrix>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
  </diagonalMatrix>
</matrixInverse>

`<matrixMatrixProduct>` element

Gets Latent Factor Model to return data with residuals computed

The element has the following contents:

Element named <left>

Containing:
- MatrixParameter element (exactly one)
Element named <right>

Containing:
- CompoundParameter element (exactly one)
Element named <ColumnMask>
Only some columns need to be multiplied
Containing:
- Parameter element (exactly one)
Element named <InPlace>
Matrix values that are returned
Containing:
- MatrixParameter element (exactly one)

Example:

<matrixMatrixProduct>
  <left>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix7">
  </left>
  <right>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
  </right>
</matrixMatrixProduct>

`<matrixParameter>` element

A matrix parameter constructed from its component parameters.

The element takes following attributes:

rows (optional) is of type Integer
columns (optional) is of type Integer
transpose (optional) is of type Boolean
asCompoundParameter (optional) is of type Boolean
test (optional) is of type Boolean

The element has the following contents:

Parameter elements (zero or more)

Example:

<matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
  <approximateFactorAnalysisPrecision>
    <L>
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </L>
    <gamma>
      <maskedParameter idref="maskedParameter3">
    </gamma>
  </approximateFactorAnalysisPrecision>
  <fastBlockUpperTriangularMatrixParameterParser transpose="true" columns="1" rows="1"/>
</matrixParameter>

`<matrixVectorProductParameter>` element

A matrix-vector product of parameters.

The element has the following contents:

Element named <matrix>

Containing:
- MatrixParameter element (exactly one)
Element named <vector>

Containing:
- Parameter element (exactly one)

Example:

<matrixVectorProductParameter>
  <matrix>
    <diagonalMatrix idref="diagonalMatrix4">
  </matrix>
  <vector>
    <productParameter idref="productParameter3">
  </vector>
</matrixVectorProductParameter>

`<mcmc>` element

This element returns an MCMC chain and runs the chain as a side effect.

The element takes following attributes:

chainLength is of type Long
autoOptimize (optional) is of type Boolean
autoOptimizeDelay (optional) is of type Integer
preBurnin (optional) is of type Integer
temperature (optional) is of type Double
fullEvaluation (optional) is of type Integer
minOpsFullEvaluations (optional) is of type Integer
evaluationThreshold (optional) is of type Double
spawn (optional) is of type Boolean
name (optional) is of type String
operatorAnalysis (optional) is of type String

The element has the following contents:

OperatorSchedule element (exactly one)
Likelihood element (exactly one)
Logger elements (one or more)

Example:

<mcmc chainLength="1" autoOptimize="true" autoOptimizeDelay="1" preBurnin="1" temperature="1.0" fullEvaluation="1" minOpsFullEvaluations="1" evaluationThreshold="1.0" spawn="true" name="foo" operatorAnalysis="foo">
  <operators sequential="true" optimizationSchedule="foo" minAcceptance="1.0" minUsage="1">
    <GibbsIndependentGammaOperator idref="GibbsIndependentGammaOperator4">
  </operators>
  <integratedFactorModel traitName="foo" nugget="1.0">
    <loadings>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </loadings>
    <precision>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix9">
    </precision>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10">
    <traitParameter>
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </traitParameter>
  </integratedFactorModel>
  <logArg logEvery="1" format="extendedNewick" fileName="foo" title="foo">
    <argTreeModel idref="argTreeModel4">
  </logArg>
</mcmc>

`<mdsModeFinder>` element

Provides a mode finder for a MDS model on a tree

The element takes following attributes:

tolerance (optional) is of type Double

The element has the following contents:

MultiDimensionalScalingLikelihood element (exactly one)
GaussianProcessRandomGenerator element (zero or one)

Example:

<mdsModeFinder tolerance="1.0">
  <multiDimensionalScalingLikelihood fileName="foo" mdsDimension="1" useOld="true" includeTruncation="true" forceReorder="true">
    <locations>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser6">
    </locations>
    <mdsPrecision>
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </mdsPrecision>
  </multiDimensionalScalingLikelihood>
</mdsModeFinder>

`<meanStatistic>` element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

Statistic elements (one or more)

Example:

<meanStatistic>
  <reciprocalStatistic>
    <productStatistic idref="productStatistic9">
  </reciprocalStatistic>
  <copyParameterValues>
    <source>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter10">
    </source>
    <destination>
      <duplicatedParameter idref="duplicatedParameter4">
    </destination>
  </copyParameterValues>
  <mvPolyaLikelihood>
    <data>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix8">
    </data>
    <alpha>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix7">
    </alpha>
  </mvPolyaLikelihood>
  <rateCovarianceStatistic name="foo">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
    <argDiscretizedBranchRates idref="argDiscretizedBranchRates8">
  </rateCovarianceStatistic>
</meanStatistic>

`<mergePatterns>` element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element has the following contents:

PatternList elements (one or more)

Example:

<mergePatterns>
  <microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
    <taxa idref="taxa9">
    <microsatellite idref="microsatellite1">
    <microsatSeq>
        1,2,3,4,5,67,100
    </microsatSeq>
  </microsatellitePattern>
</mergePatterns>

`<MetagenomeData>` element

Data representing metagenome reads aligned to reference sequences and a reference tree

The element takes following attributes:

fixedReferenceTree (optional) is of type Boolean

“Whether the reference tree should be of fixed topology”

The element has the following contents:

One of:
- Taxa element (exactly one)
- Tree element (exactly one)
Alignment element (exactly one)
LinkageConstraints element (zero or one)

Example:

<MetagenomeData fixedReferenceTree="true">
  <taxa>
    <sp idref="sp9">
    <taxon idref="taxon1">
    <sp idref="sp6">
    <apsp idref="apsp3">
  </taxa>
  <hypermutantAlignment type="all">
    <convert idref="convert4">
  </hypermutantAlignment>
</MetagenomeData>

`<microsatellite>` element

This element represents a microsatellite data type.

The element has the following contents:

All of:
- id is of type String
- min is of type Integer
- max is of type Integer
- unitLength (optional) is of type Integer

Example:

<microsatellite min="0" max="20" unitLength="2"/>```



### <code>&lt;microsatellitePattern&gt;</code> element

This element represents a microsatellite pattern.

The element takes following attributes:

* <code>id</code>  is of type [String](#string)
: "the name of the locus"

* <code>printDetails</code> (optional) is of type [Boolean](#boolean)
: 

* <code>printMsatPatContent</code> (optional) is of type [Boolean](#boolean)
: 

The element has the following contents:

* [Taxa](#taxa) element (exactly one)

* [Microsatellite](#microsatellite) element (exactly one)

* Element named <code>&lt;microsatSeq&gt;</code>

    Containing:

    * [String](#string) element (exactly one)
: A string of numbers representing the microsatellite lengths for a locus

Example:

```html
<microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
  <taxa>
    <individual idref="individual3">
    <sp idref="sp1">
    <sp idref="sp6">
  </taxa>
  <microsatellite/>
  <microsatSeq>
      1,2,3,4,5,67,100
  </microsatSeq>
</microsatellitePattern>

`<microsatelliteSamplerTreeModel>` element

This parser returns a TreeMicrosatelliteSamplerModel Object

The element takes following attributes:

provideInternalNodeValues (optional) is of type Boolean

The element has the following contents:

Element named <tree>

Containing:
- TreeModel element (exactly one)
Element named <internalValues>

Containing:
- Parameter element (exactly one)
Element named <externalValues>

Containing:
- Patterns element (exactly one)

Example:

<microsatelliteSamplerTreeModel provideInternalNodeValues="true">
  <tree>
    <starTreeModel idref="starTreeModel4">
  </tree>
  <internalValues>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter3">
  </internalValues>
  <externalValues>
    <microsatelliteSimulator idref="microsatelliteSimulator5">
  </externalValues>
</microsatelliteSamplerTreeModel>

`<microsatelliteSimulator>` element

This parser facilliates simulation of microsatellites given a tree and infinitesimal rate model

The element has the following contents:

Microsatellite element (exactly one)
Taxa element (exactly one)
Tree element (exactly one)
MicrosatelliteModel element (exactly one)
BranchRateModel element (zero or one)

Example:

<microsatelliteSimulator>
  <microsatellite/>
  <taxa>
    <individual idref="individual9">
    <individual idref="individual9">
    <sp idref="sp5">
  </taxa>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <tree idref="tree1">
    <rootHeight>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter6">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </nodeHeights>
    <leafHeight taxon="foo">
      <immutableParameter idref="immutableParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <dataFromTreeTips idref="dataFromTreeTips10">
    </leafHeight>
    <leafHeight taxon="foo">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <mvPolyaLikelihood idref="mvPolyaLikelihood4">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues10">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundParameter idref="compoundParameter2">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak6">
    </outbreak>
  </partitionedTreeModel>
  ERROR!
</microsatelliteSimulator>

`<microsatUpDownOperator>` element

This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.

The element takes following attributes:

scaleFactor is of type Double
weight is of type Double
autoOptimize (optional) is of type Boolean

The element has the following contents:

Element named <up>

Containing:
- Parameter element (zero or one)
Element named <down>

Containing:
- Parameter element (zero or one)

Example:

<microsatUpDownOperator scaleFactor="1.0" weight="1.0" autoOptimize="true">
  <up/>
  <up/>
  <up/>
  <up/>
  <down/>
  <down/>
  <down/>
</microsatUpDownOperator>

`<mixedDistributionLikelihood>` element

Calculates the likelihood of some data given some mix of parametric distributions.

The element has the following contents:

Element named <distribution0>

Containing:
- ParametricDistributionModel element (exactly one)
Element named <distribution1>

Containing:
- ParametricDistributionModel element (exactly one)
Element named <data>

Containing:
- Statistic element (exactly one)
Element named <indicators>

Containing:
- Statistic element (exactly one)

Example:

<mixedDistributionLikelihood>
  <distribution0>
    <onePGammaDistributionModel idref="onePGammaDistributionModel6">
  </distribution0>
  <distribution1>
    <exponentialDistributionModel idref="exponentialDistributionModel1">
  </distribution1>
  <data>
    <jointParameter idref="jointParameter5">
  </data>
  <indicators>
    <bdcNClustersStatistic idref="bdcNClustersStatistic4">
  </indicators>
</mixedDistributionLikelihood>

`<mixtureCartogramDiffusionModel>` element

Describes a bivariate diffusion process using cartogram distances.

The element has the following contents:

Parameter element (exactly one)
Element named <mixture>

Containing:
- Parameter element (exactly one)
Element named <boundingBox>

Containing:
- minX is of type Double
- maxX is of type Double
- minY is of type Double
- maxY is of type Double

Example:

<mixtureCartogramDiffusionModel>
  <designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
    <matrixVectorProductParameter idref="matrixVectorProductParameter1">
  </designMatrix>
  <mixture>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix3">
  </mixture>
  <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/>
</mixtureCartogramDiffusionModel>

`<mixtureModel>` element

This element represents a finite mixture of likelihood models.

The element takes following attributes:

normalize (optional) is of type Boolean

The element has the following contents:

Likelihood elements ( or more)
Parameter element (exactly one)

Example:

<mixtureModel normalize="true">
  <multivariateNormalPrior>
    <meanParameter>
      <jointParameter idref="jointParameter7">
    </meanParameter>
    <precisionParameter>
      <compoundMatrixParameter idref="compoundMatrixParameter10">
    </precisionParameter>
    <transform idref="transform4">
    <transform idref="transform7">
  </multivariateNormalPrior>
  <gammaReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
    <matrixMatrixProduct idref="matrixMatrixProduct1">
  </gammaReferencePrior>
  <treeDataLikelihood useAmbiguities="true" scalingScheme="foo">
    <partition>
      <microsatelliteSimulator idref="microsatelliteSimulator6">
      <siteModel idref="siteModel8">
    </partition>
    <treeModel idref="treeModel7">
  </treeDataLikelihood>
  <productParameter>
    <vectorSlice idref="vectorSlice5">
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView6">
    <mvPolyaLikelihood idref="mvPolyaLikelihood2">
  </productParameter>
</mixtureModel>

`<mixtureModelBranchRates>` element

This element returns a random discretized relaxed clock model.The branch rates are drawn from a continuous parametric distribution.

The element takes following attributes:

singleRootRate (optional) is of type Boolean

“Whether only a single rate should be used for the two children branches of the root”
normalize (optional) is of type Boolean

“Whether the mean rate has to be normalized to a particular value”
normalizeBranchRateTo (optional) is of type Double

“The mean rate to normalize to, if normalizing”
useQuantilesForRates (optional) is of type Boolean

“Whether or not to use quantiles to represent rates. If false then rates are not drawn specifically from any of the distributions”

The element has the following contents:

TreeModel element (exactly one)
Element named <distribution>
The distribution model for rates among branches
Containing:
- ParametricDistributionModel element (exactly one)
Element named <distributionIndex>
Operator that switches between the distributions of the branch rate distribution model
Containing:
- Parameter element (exactly one)
Element named <rateCategoryQuantiles>
The quantiles for
Containing:
- Parameter element (exactly one)

Example:

<mixtureModelBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0" useQuantilesForRates="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <partitionedTreeModel idref="partitionedTreeModel7">
  </empiricalTreeDistributionModel>
  <distribution>
    <inverseGammaDistributionModel idref="inverseGammaDistributionModel9">
  </distribution>
  <distribution>
    <onePGammaDistributionModel idref="onePGammaDistributionModel6">
  </distribution>
  <distribution>
    <inverseGammaDistributionModel idref="inverseGammaDistributionModel6">
  </distribution>
  <distributionIndex>
    <vectorSlice idref="vectorSlice9">
  </distributionIndex>
  <rateCategoryQuantiles>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </rateCategoryQuantiles>
</mixtureModelBranchRates>

`<mixtureModelLikelihood>` element

This element represents a finite mixture of likelihood models.

The element takes following attributes:

normalize (optional) is of type Boolean

The element has the following contents:

Likelihood elements ( or more)
Parameter element (exactly one)

Example:

<mixtureModelLikelihood normalize="true">
  <multiDimensionalScalingLikelihood fileName="foo" mdsDimension="1" useOld="true" includeTruncation="true" forceReorder="true">
    <locations>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </locations>
    <mdsPrecision>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
    </mdsPrecision>
  </multiDimensionalScalingLikelihood>
  <alsTreeLikelihood useAmbiguities="true" storePartials="true" integrateGainRate="true" forceRescaling="true">
    <convert idref="convert4">
    <starTreeModel idref="starTreeModel7">
    ERROR!
    <observationProcess type="foo" taxon="foo"/>
  </alsTreeLikelihood>
  <argLocalClock/>
  <adaptableSizeFastMatrixParameter columns="1" rows="1" maxRowSize="1" maxColumnSize="1" startingValue="1.0" lowerTriangle="true"/>
</mixtureModelLikelihood>

`<modeFindOperator>` element

This element returns a mode finder that always accepts.

The element takes following attributes:

maxTimes (optional) is of type Integer
weight is of type Double
autoOptimize (optional) is of type Boolean
sd (optional) is of type Double

The element has the following contents:

MultiDimensionalScalingMM element (exactly one)

Example:

<modeFindOperator maxTimes="1" weight="1.0" autoOptimize="true" sd="1.0">
  ERROR!
</modeFindOperator>

`<modeIndependenceOperator>` element

This element returns a multivariate normal random walk operator on a given parameter.

The element takes following attributes:

scaleFactor is of type Double
weight is of type Double
autoOptimize (optional) is of type Boolean
formXtXInverse (optional) is of type Boolean

The element has the following contents:

Parameter element (exactly one)
Element named <varMatrix>

Containing:
- MatrixParameter element (exactly one)

Example:

<modeIndependenceOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" formXtXInverse="true">
  <matrixMatrixProduct>
    <left>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView8">
    </left>
    <right>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
    </right>
  </matrixMatrixProduct>
  <varMatrix>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
  </varMatrix>
</modeIndependenceOperator>

`<modelSpecificPseudoPrior>` element

Calculates the likelihood of some data given some parametric or empirical distribution.

Example:

<modelSpecificPseudoPrior/>

`<monophylyStatistic>` element

A statistic that returns true if a given set of taxa are monophyletic for a given tree

The element takes following attributes:

name (optional) is of type String

“A name for this statistic for the purpose of logging”
inverse (optional) is of type Boolean

“inverse, returns 0/false when monophyletic and 1/true when not monophyletic”

The element has the following contents:

Tree element (exactly one)
Element named <mrca>

Containing:
- One of:
  - Taxon elements (one or more)
  - Taxa element (exactly one)
Element named <ignore>
An optional list of taxa to ignore from the test of monophyly
Containing:
- One of:
  - Taxon elements (one or more)
  - Taxa element (exactly one)

Example:

<monophylyStatistic name="foo" inverse="true">
  <newick usingDates="true" usingHeights="true" rescaleHeight="1.0" rescaleLength="1.0" units="days">
    foo
  </newick>
  <mrca>
    <taxa idref="taxa1">
  </mrca>
</monophylyStatistic>

`<monotonicStatistic>` element

The element takes following attributes:

order (optional) is of type String
strictlyMonotic (optional) is of type Boolean

The element has the following contents:

Statistic elements (one or more)

Example:

<monotonicStatistic order="foo" strictlyMonotic="true">
  <diffusionRateCovarianceStatistic name="foo" greatCircleDistance="true" diffusionCoefficient="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
    <inhibitionLikelihood idref="inhibitionLikelihood4">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood10">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood10">
    <inhibitionLikelihood idref="inhibitionLikelihood5">
  </diffusionRateCovarianceStatistic>
</monotonicStatistic>

`<moveLegs>` element

Operator which changes the way a tetraploid subtree joins the diploid tree.

The element takes following attributes:

weight is of type Double

The element has the following contents:

AlloppSpeciesBindings element (exactly one)
AlloppSpeciesNetworkModel element (exactly one)

Example:

<moveLegs weight="1.0">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp10">
    <apsp idref="apsp10">
    <geneTrees>
      <starTreeModel idref="starTreeModel6">
      <partitionedTreeModel idref="partitionedTreeModel7">
      <gtree popfactor="1.0">
        <starTreeModel idref="starTreeModel2">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies5">
    <tipPopulations value="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter7">
    </tipPopulations>
    <rootPopulations value="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter9">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <compoundMatrixParameter idref="compoundMatrixParameter9">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</moveLegs>

`<mrcaTraitStatistic>` element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

name (optional) is of type String

“A name for this statistic primarily for the purposes of logging”
trait is of type String

“The name of the trait (can be rate)”
rate (optional) is of type Boolean

The element has the following contents:

TreeModel element (exactly one)
Element named <mrca>

Containing:
- Taxa element (exactly one)

Example:

<mrcaTraitStatistic name="foo" trait="foo" rate="true">
  <treeModel fixHeights="true" fixTree="true">
    <rescaledTree idref="rescaledTree4">
    <rootHeight>
      <designMatrix idref="designMatrix10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter2">
    </nodeHeights>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser5">
    </leafHeight>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter4">
    </leafHeight>
    <leafHeight taxon="foo">
      <vectorSlice idref="vectorSlice2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <duplicatedParameter idref="duplicatedParameter8">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceParameter idref="differenceParameter4">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <productParameter idref="productParameter5">
    </leafTrait>
  </treeModel>
  <mrca>
    <taxa idref="taxa4">
  </mrca>
</mrcaTraitStatistic>

`<MsatFullAncestryImportanceSamplingOperator>` element

This element represents an operator that samples the full ancestry given a microsatellite pattern and a tree

The element takes following attributes:

weight is of type Double

The element has the following contents:

Parameter element (exactly one)
MicrosatelliteSamplerTreeModel element (exactly one)
MicrosatelliteModel element (exactly one)
BranchRateModel element (exactly one)

Example:

<MsatFullAncestryImportanceSamplingOperator weight="1.0">
  <duplicatedParameter>
    <maskedParameter idref="maskedParameter5">
    <copies>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </copies>
  </duplicatedParameter>
  <microsatelliteSamplerTreeModel provideInternalNodeValues="true">
    <tree>
      <treeModel idref="treeModel7">
    </tree>
    <internalValues>
      <immutableParameter idref="immutableParameter2">
    </internalValues>
    <externalValues>
      <microsatellitePattern idref="microsatellitePattern9">
    </externalValues>
  </microsatelliteSamplerTreeModel>
  ERROR!
  <rateEpochBranchRates continuousNormalization="true">
    <epoch transitionTime="1.0">
      <mvPolyaLikelihood idref="mvPolyaLikelihood8">
    </epoch>
    <rate>
      <matrixMatrixProduct idref="matrixMatrixProduct2">
    </rate>
  </rateEpochBranchRates>
</MsatFullAncestryImportanceSamplingOperator>

`<msatModelSelectOperator>` element

This element returns a microsatellite averaging operator on a given parameter.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Element named <modelChoose>

Containing:
- Parameter element (exactly one)
Element named <modelIndicators>

Containing:
- Parameter elements (one or more)

Example:

<msatModelSelectOperator weight="1.0">
  <modelChoose>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
  </modelChoose>
  <modelIndicators>
    <vectorSlice idref="vectorSlice4">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter9">
    <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    <complementParameter idref="complementParameter4">
  </modelIndicators>
</msatModelSelectOperator>

`<msatModelSwitchOperator>` element

This element returns a microsatellite averaging operator on a given parameter.

The element takes following attributes:

weight is of type Double

The element has the following contents:

Element named <modelChoose>

Containing:
- Parameter element (exactly one)
Element named <dependencies>

Containing:
- Parameter element (exactly one)
Element named <variableIndices>

Containing:
- Parameter element (exactly one)

Example:

<msatModelSwitchOperator weight="1.0">
  <modelChoose>
    <vectorSlice idref="vectorSlice1">
  </modelChoose>
  <dependencies>
    <compoundParameter idref="compoundParameter10">
  </dependencies>
</msatModelSwitchOperator>

`<msatPatternStatistic>` element

Returns MsatPatternStatistic object

The element takes following attributes:

mode (optional) is of type String

The element has the following contents:

Patterns element (exactly one)

Example:

<msatPatternStatistic mode="foo">
  <microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
    <taxa idref="taxa5">
    <microsatellite idref="microsatellite7">
    <microsatSeq>
        1,2,3,4,5,67,100
    </microsatSeq>
  </microsatellitePattern>
</msatPatternStatistic>

`<MsatSingleAncestralStateGibbsOperator>` element

This element represents an operator that samples the state of a single ancestor given a microsatellite pattern and a tree

The element takes following attributes:

weight is of type Double

The element has the following contents:

Parameter element (exactly one)
MicrosatelliteSamplerTreeModel element (exactly one)
MicrosatelliteModel element (exactly one)
BranchRateModel element (exactly one)

Example:

<MsatSingleAncestralStateGibbsOperator weight="1.0">
  <mvPolyaLikelihood>
    <data>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter1">
    </data>
    <alpha>
      <differenceMatrixParameter idref="differenceMatrixParameter1">
    </alpha>
  </mvPolyaLikelihood>
  <microsatelliteSamplerTreeModel provideInternalNodeValues="true">
    <tree>
      <partitionedTreeModel idref="partitionedTreeModel1">
    </tree>
    <internalValues>
      <sumParameter idref="sumParameter7">
    </internalValues>
    <externalValues>
      <microsatellitePattern idref="microsatellitePattern5">
    </externalValues>
  </microsatelliteSamplerTreeModel>
  ERROR!
  <strictClockBranchRates>
    <rate>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
    </rate>
  </strictClockBranchRates>
</MsatSingleAncestralStateGibbsOperator>

`<mulMSCoalescent>` element

Compute coalecent log-liklihood of a set of gene trees embedded inside one species tree.

The element has the following contents:

MulSpeciesBindings element (exactly one)
MulSpeciesTreeModel element (exactly one)

Example:

<mulMSCoalescent>
  <mulSpecies>
    <apsp idref="apsp1">
    <apsp idref="apsp4">
    <apsp idref="apsp5">
    <geneTrees>
      <partitionedTreeModel idref="partitionedTreeModel7">
      <gtree popfactor="1.0">
        <treeModel idref="treeModel2">
      </gtree>
      <gtree popfactor="1.0">
        <partitionedTreeModel idref="partitionedTreeModel2">
      </gtree>
      <gtree popfactor="1.0">
        <treeModel idref="treeModel8">
      </gtree>
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
      </gtree>
    </geneTrees>
  </mulSpecies>
  <mulSpeciesTree constantRoot="true" constantPopulation="true">
    <mulSpecies idref="mulSpecies3">
    <sppSplitPopulations value="1.0">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
    </sppSplitPopulations>
  </mulSpeciesTree>
</mulMSCoalescent>

`<mulSpecies>` element

Binds taxa to gene trees with information about possibly allopolyploid species.

The element has the following contents:

AlloppSpeciesBindings$ApSpInfo elements ( or more)
Element named <geneTrees>

Containing:
- TreeModel elements (zero or more)
- Element named <gtree>
  
  Containing:
  - popfactor is of type Double
  - TreeModel element (exactly one)

Example:

<mulSpecies>
  <apsp ploidylevel="1.0">
    <individual idref="individual7">
  </apsp>
  <apsp ploidylevel="1.0">
    <individual idref="individual3">
    <individual idref="individual2">
    <individual idref="individual7">
  </apsp>
  <geneTrees>
    <gtree popfactor="1.0">
      <partitionedTreeModel idref="partitionedTreeModel10">
    </gtree>
    <gtree popfactor="1.0">
      <partitionedTreeModel idref="partitionedTreeModel2">
    </gtree>
    <gtree popfactor="1.0">
      <treeModel idref="treeModel4">
    </gtree>
  </geneTrees>
</mulSpecies>

`<mulSpeciesTree>` element

Multiply-labelled species tree which includes demographic function per branch.

The element takes following attributes:

constantRoot (optional) is of type Boolean
constantPopulation (optional) is of type Boolean

The element has the following contents:

MulSpeciesBindings element (exactly one)
Tree element (zero or one)
Element named <sppSplitPopulations>

Containing:
- value (optional) is of type Double
- Parameter element (exactly one)

Example:

<mulSpeciesTree constantRoot="true" constantPopulation="true">
  <mulSpecies>
    <apsp idref="apsp4">
    <apsp idref="apsp9">
    <geneTrees>
      <partitionedTreeModel idref="partitionedTreeModel10">
    </geneTrees>
  </mulSpecies>
  <sppSplitPopulations value="1.0">
    <copyParameterValues idref="copyParameterValues10">
  </sppSplitPopulations>
</mulSpeciesTree>

`<mulSpeciesTreePrior>` element

Prior for a multiply-labelled species tree for allopolyploids.

The element has the following contents:

Element named <model>

Containing:
- SpeciationModel element (exactly one)
Element named <mulTree>

Containing:
- MulSpeciesTreeModel element (exactly one)

Example:

<mulSpeciesTreePrior>
  <model>
    <randomLocalYuleModel idref="randomLocalYuleModel5">
  </model>
  <mulTree>
    <mulSpeciesTree idref="mulSpeciesTree4">
  </mulTree>
</mulSpeciesTreePrior>

`<multiDimensionalScalingLikelihood>` element

Provides the likelihood of pairwise distance given vectors of coordinatesfor points according to the multidimensional scaling scheme of XXX & Rafferty (xxxx).

The element takes following attributes:

fileName is of type String

“The name of the file containing the assay table”
mdsDimension is of type Integer

“The dimension of the space for MDS”
useOld (optional) is of type Boolean
includeTruncation (optional) is of type Boolean
forceReorder (optional) is of type Boolean

The element has the following contents:

Element named <locations>

Containing:
- MatrixParameterInterface element (exactly one)
Element named <mdsPrecision>

Containing:
- Parameter element (exactly one)

Example:

<multiDimensionalScalingLikelihood fileName="foo" mdsDimension="1" useOld="true" includeTruncation="true" forceReorder="true">
  <locations>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView4">
  </locations>
  <mdsPrecision>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
  </mdsPrecision>
</multiDimensionalScalingLikelihood>

`<multiEpochExponential>` element

A demographic model of multi-phae exponential growth.

The element takes following attributes:

units is of type String

“the units”

The element has the following contents:

Element named <populationSize>

Containing:
- Parameter element (exactly one)
Element named <growthRate>

Containing:
- Parameter element (exactly one)
Element named <transitionTime>

Containing:
- Parameter element (exactly one)

Example:

<multiEpochExponential units="months">
  <populationSize>
    <jointParameter idref="jointParameter9">
  </populationSize>
  <growthRate>
    <diagonalMatrix idref="diagonalMatrix9">
  </growthRate>
  <transitionTime>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
  </transitionTime>
</multiEpochExponential>

`<multiLociDistance>` element

Constructs a distance matrix from a pattern list or alignment

The element has the following contents:

DistanceMatrix elements (one or more)

Example:

<multiLociDistance>
  <distanceMatrix correction="SMM">
    <alignment idref="alignment5">
  </distanceMatrix>
  <distanceMatrix correction="SMM">
    <patternSubSet idref="patternSubSet1">
  </distanceMatrix>
  <distanceMatrix correction="JC">
    <alignment idref="alignment2">
  </distanceMatrix>
  <distanceMatrix correction="JC">
    <patternSubSet idref="patternSubSet8">
  </distanceMatrix>
</multiLociDistance>

`<multivariateDiffusionModel>` element

Describes a multivariate normal diffusion process.

The element has the following contents:

Element named <precisionMatrix>

Containing:
- MatrixParameterInterface element (exactly one)

Example:

<multivariateDiffusionModel>
  <precisionMatrix>
    <diagonalMatrix idref="diagonalMatrix10">
  </precisionMatrix>
</multivariateDiffusionModel>

`<multivariateDistributionLikelihood>` element

Calculates the likelihood of some data under a given multivariate distribution.

The element takes following attributes:

dataAsMatrix (optional) is of type Boolean

The element has the following contents:

Element named <distribution>

Containing:
- ParametricMultivariateDistributionModel element (exactly one)
Transform$ParsedTransform elements (zero or more)
Element named <data>

Containing:
- Parameter elements (one or more)

Example:

<multivariateDistributionLikelihood dataAsMatrix="true">
  <distribution>
    <treeTraitNormalDistribution idref="treeTraitNormalDistribution6">
  </distribution>
  <composedTransform>
    <outer>
      <composedTransform idref="composedTransform8">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform2">
    </inner>
  </composedTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform1">
    </outer>
    <inner>
      <composedTransform idref="composedTransform8">
    </inner>
  </composedTransform>
</multivariateDistributionLikelihood>

`<multivariateGammaPrior>` element

Calculates the likelihood of some data under a given multivariate-gamma distribution.

The element has the following contents:

One of:
- Element named <shapeParameter>
  
  Containing:
  - Parameter element (exactly one)
- Element named <meanParameter>
  
  Containing:
  - Parameter element (exactly one)
One of:
- Element named <scaleParameter>
  
  Containing:
  - Parameter element (exactly one)
- Element named <coefficientOfVariation>
  
  Containing:

BEAST XML Elements

<adaptableSizeFastMatrixParameter> element

<adaptableVarianceMultivariateNormalOperator> element

<addremoveARGEvent> element

<aicmAnalysis> element

<alignment> element

<alloppNetworkPriorModel> element

<alloppNumHybsStatistic> element

<alloppspecies> element

<alloppSpeciesNetwork> element

<alsTreeLikelihood> element

<aminoAcidModel> element

<ancestralTrait> element

<ancestralTrait> element

<ancestralTreeLikelihood> element

<antigenicDriftPrior> element

<antigenicLikelihood> element

<appendedPotentialDerivative> element

<approximateFactorAnalysisPrecision> element

<apsp> element

<apspCoalescent> element

<apspNetworkPrior> element

<arbitraryBranchRates> element

<argCoalescentLikelihood> element

<argDiscretizedBranchRates> element

<ARGEventOperator> element

<argLocalClock> element

<argTreeModel> element

<argPartitionOperator> element

<argRatePrior> element

<argReassortmentNodeCount> element

<argSubtreeSlide> element

<argSwapOperator> element

<argTimingStatistic> element

<argTotalLengthStatistic> element

<argTraceAnalysis> element

<argTreeCount> element

<argTreeLikelihood> element

<argTreeModel> element

<argWideExchange> element

<arithmeticMeanAnalysis> element

<array> element

<ascertainedPatterns> element

<attr> element

<attributeBranchRateModel> element

<attributePatterns> element

<attributes> element

<bdcNClustersStatistic> element

<beagleBranchLikelihood> element

<beagleOperationReport> element

<benchmarker> element

<betaDistributionModel> element

<betaPrior> element

<betaSplittingModel> element

<biasedMultivariateDiffusionModel> element

<bifractionalDiffusionModel> element

<binaryCovarionModel> element

<binarySubstitutionModel> element

<binomialLikelihood> element

<birthDeathCollapseModel> element

<birthDeathEpidemiology> element

<birthDeathModel> element

<birthDeathSerialSampling> element

<bitFlipInSubstitutionModelOperator> element

<bitFlipOperator> element

<bitMoveOperator> element

<bitSwapOperator> element

<blockUpperTriangularMatrixParameter> element

<booleanLikelihood> element

<branchAssignmentModel> element

<branchCategories> element

<branchDirections> element

<branchingLikelihood> element

<branchMagnitudes> element

<branchSpecificSubstitutionModel> element

<branchSpecificTrait> element

<BrownianMotion> element

<buildCompoundSymmetricMatrix> element

<cachedPrior> element

`<adaptableSizeFastMatrixParameter>` element

`<adaptableVarianceMultivariateNormalOperator>` element

`<addremoveARGEvent>` element

`<aicmAnalysis>` element

`<alignment>` element

`<alloppNetworkPriorModel>` element

`<alloppNumHybsStatistic>` element

`<alloppspecies>` element

`<alloppSpeciesNetwork>` element

`<alsTreeLikelihood>` element

`<aminoAcidModel>` element

`<ancestralTrait>` element

`<ancestralTrait>` element

`<ancestralTreeLikelihood>` element

`<antigenicDriftPrior>` element

`<antigenicLikelihood>` element

`<appendedPotentialDerivative>` element

`<approximateFactorAnalysisPrecision>` element

`<apsp>` element

`<apspCoalescent>` element

`<apspNetworkPrior>` element

`<arbitraryBranchRates>` element

`<argCoalescentLikelihood>` element

`<argDiscretizedBranchRates>` element

`<ARGEventOperator>` element

`<argLocalClock>` element

`<argTreeModel>` element

`<argPartitionOperator>` element

`<argRatePrior>` element

`<argReassortmentNodeCount>` element

`<argSubtreeSlide>` element

`<argSwapOperator>` element

`<argTimingStatistic>` element

`<argTotalLengthStatistic>` element

`<argTraceAnalysis>` element

`<argTreeCount>` element

`<argTreeLikelihood>` element

`<argTreeModel>` element

`<argWideExchange>` element

`<arithmeticMeanAnalysis>` element

`<array>` element

`<ascertainedPatterns>` element

`<attr>` element

`<attributeBranchRateModel>` element

`<attributePatterns>` element

`<attributes>` element

`<bdcNClustersStatistic>` element

`<beagleBranchLikelihood>` element

`<beagleOperationReport>` element

`<benchmarker>` element

`<betaDistributionModel>` element

`<betaPrior>` element

`<betaSplittingModel>` element

`<biasedMultivariateDiffusionModel>` element

`<bifractionalDiffusionModel>` element

`<binaryCovarionModel>` element

`<binarySubstitutionModel>` element

`<binomialLikelihood>` element

`<birthDeathCollapseModel>` element

`<birthDeathEpidemiology>` element

`<birthDeathModel>` element

`<birthDeathSerialSampling>` element

`<bitFlipInSubstitutionModelOperator>` element

`<bitFlipOperator>` element

`<bitMoveOperator>` element

`<bitSwapOperator>` element

`<blockUpperTriangularMatrixParameter>` element

`<booleanLikelihood>` element

`<branchAssignmentModel>` element

`<branchCategories>` element

`<branchDirections>` element

`<branchingLikelihood>` element

`<branchMagnitudes>` element

`<branchSpecificSubstitutionModel>` element

`<branchSpecificTrait>` element

`<BrownianMotion>` element

`<buildCompoundSymmetricMatrix>` element

`<cachedPrior>` element

`<cartogramDiffusionModel>` element

`<caseToCaseTransmissionLikelihood>` element