XML

BEAST XML Elements

The following is a list of valid elements in a beast file.

<adaptableSizeFastMatrixParameter> element

Returns a blockUpperTriangularMatrixParameter which is a compoundParameter which forces the last element to be of full length, the second to last element to be of full length-1, etc.

The element takes following attributes:

  • columns (optional) is of type Integer
  • rows (optional) is of type Integer
  • maxRowSize (optional) is of type Integer
  • maxColumnSize (optional) is of type Integer
  • startingValue (optional) is of type Double
  • lowerTriangle (optional) is of type Boolean

Example:

<adaptableSizeFastMatrixParameter columns="1" rows="1" maxRowSize="1" maxColumnSize="1" startingValue="1.0" lowerTriangle="true"/>

<adaptableVarianceMultivariateNormalOperator> element

This element returns an adaptable variance multivariate normal operator on a given parameter.

The element takes following attributes:

  • scaleFactor is of type Double
  • weight is of type Double
  • beta is of type Double
  • coefficient is of type Double
  • initial is of type Integer
  • burnin (optional) is of type Integer
  • updateEvery (optional) is of type Integer
  • autoOptimize (optional) is of type Boolean
  • formXtXInverse (optional) is of type Boolean
  • skipRankCheck (optional) is of type Boolean

The element has the following contents:

Example:

<adaptableVarianceMultivariateNormalOperator scaleFactor="1.0" weight="1.0" beta="1.0" coefficient="1.0" initial="1" burnin="1" updateEvery="1" autoOptimize="true" formXtXInverse="true" skipRankCheck="true">
  <mvPolyaLikelihood>
    <data>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </data>
    <alpha>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix4">
    </alpha>
  </mvPolyaLikelihood>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform8">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform10">
    </inner>
  </composedTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform10">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform8">
    </inner>
  </composedTransform>
  <inverseTransform>
    <inverseTransform idref="inverseTransform1">
  </inverseTransform>
</adaptableVarianceMultivariateNormalOperator>

<addremoveARGEvent> element

An operator that slides a subarg.

The element takes following attributes:

The element has the following contents:

Example:

<addremoveARGEvent weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel partitionType="reassortment">
    <starTreeModel idref="starTreeModel5">
    <rootHeight>
      <complementParameter idref="complementParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <sumParameter idref="sumParameter6">
    </nodeHeights>
  </argTreeModel>
</addremoveARGEvent>

<aicmAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

  • fileName is of type String
    “The traceName of a BEAST log file (can not include trees, which should be logged separately”
  • burnIn (optional) is of type Integer
  • bootstrapLength (optional) is of type Integer

The element has the following contents:

  • Element named <likelihoodColumn>

    Containing:

    • name is of type String
      “The column name”

Example:

<aicmAnalysis fileName="foo" burnIn="1" bootstrapLength="1">
  <likelihoodColumn name="foo"/>
</aicmAnalysis>

<alignment> element

This element represents an alignment of molecular sequences.

The element has the following contents:

  • One of:
    • dataType is of type String
      “The data type”
    • DataType element (exactly one)
  • Sequence elements (one or more)

Example:

<!-- An alignment of three short DNA sequences -->
<alignment missing="-?" dataType="nucleotide">
  <sequence>
    <taxon idref="taxon1"/>
    ACGACTAGCATCGAGCTTCG--GATAGCAGGC
  </sequence>
  <sequence>
    <taxon idref="taxon2"/>
    ACGACTAGCATCGAGCTTCGG-GATAGCATGC
  </sequence>
  <sequence>
    <taxon idref="taxon3"/>
    ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
  </sequence>
</alignment>

<alloppNetworkPriorModel> element

Model for speciation, extinction, hybridization in allopolyploid network.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

Example:

<alloppNetworkPriorModel units="days">
  <eventRate>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter9">
  </eventRate>
  <populationScalingFactor>
    <immutableParameter idref="immutableParameter9">
  </populationScalingFactor>
  <tipPopulationDistribution>
    <normalDistributionModel idref="normalDistributionModel1">
  </tipPopulationDistribution>
  <rootPopulationDistribution>
    <negativeBinomialDistributionModel idref="negativeBinomialDistributionModel1">
  </rootPopulationDistribution>
  <hybridPopulationDistribution>
    <onePGammaDistributionModel idref="onePGammaDistributionModel4">
  </hybridPopulationDistribution>
</alloppNetworkPriorModel>

<alloppNumHybsStatistic> element

Statistic for number of hybridizations in allopolyploid network

The element has the following contents:

Example:

<alloppNumHybsStatistic>
  <apspNetwork>
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork6">
  </apspNetwork>
</alloppNumHybsStatistic>

<alloppspecies> element

Binds taxa to gene trees with information about possibly allopolyploid species.

The element takes following attributes:

  • minGeneNodeHeight is of type Double

The element has the following contents:

Example:

<alloppspecies minGeneNodeHeight="1.0">
  <apsp ploidylevel="1.0">
    <individual idref="individual3">
    <individual idref="individual4">
    <individual idref="individual10">
    <individual idref="individual8">
  </apsp>
  <apsp ploidylevel="1.0">
    <individual idref="individual4">
    <individual idref="individual2">
    <individual idref="individual10">
    <individual idref="individual1">
  </apsp>
  <geneTrees>
    <partitionedTreeModel idref="partitionedTreeModel1">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
    <treeModel idref="treeModel6">
    <gtree popfactor="1.0">
      <partitionedTreeModel idref="partitionedTreeModel9">
    </gtree>
    <gtree popfactor="1.0">
      <treeModel idref="treeModel10">
    </gtree>
    <gtree popfactor="1.0">
      <starTreeModel idref="starTreeModel1">
    </gtree>
  </geneTrees>
</alloppspecies>

<alloppSpeciesNetwork> element

Species network with population sizes along branches

The element takes following attributes:

  • oneHybridization (optional) is of type Boolean
  • diploidRootIsRoot (optional) is of type Boolean

The element has the following contents:

  • AlloppSpeciesBindings element (exactly one)

  • Element named <tipPopulations>

    Containing:

  • Element named <rootPopulations>

    Containing:

  • Element named <hybridPopulations>

    Containing:

Example:

<alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp8">
    <apsp idref="apsp1">
    <apsp idref="apsp8">
    <apsp idref="apsp1">
    <geneTrees>
      <partitionedTreeModel idref="partitionedTreeModel9">
      <starTreeModel idref="starTreeModel6">
      <starTreeModel idref="starTreeModel9">
    </geneTrees>
  </alloppspecies>
  <tipPopulations value="1.0">
    <maskedMatrixParameter idref="maskedMatrixParameter4">
  </tipPopulations>
  <rootPopulations value="1.0">
    <matrixVectorProductParameter idref="matrixVectorProductParameter2">
  </rootPopulations>
  <hybridPopulations value="1.0">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
  </hybridPopulations>
</alloppSpeciesNetwork>

<alsTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

  • useAmbiguities (optional) is of type Boolean
  • storePartials (optional) is of type Boolean
  • integrateGainRate is of type Boolean
  • forceRescaling (optional) is of type Boolean

The element has the following contents:

Example:

<alsTreeLikelihood useAmbiguities="true" storePartials="true" integrateGainRate="true" forceRescaling="true">
  <constantPatterns>
    <categoryOutbreak idref="categoryOutbreak3">
    <counts>
      <vectorSlice idref="vectorSlice8">
    </counts>
  </constantPatterns>
  <treeModel fixHeights="true" fixTree="true">
    <tree idref="tree5">
    <rootHeight>
      <duplicatedParameter idref="duplicatedParameter1">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundParameter idref="compoundParameter6">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter5">
    </nodeHeights>
    <leafHeight taxon="foo">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter1">
    </leafHeight>
    <leafHeight taxon="foo">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision5">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter8">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <copyParameterValues idref="copyParameterValues3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter6">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter3">
    </leafTrait>
  </treeModel>
  ERROR!
  <observationProcess type="foo" taxon="foo"/>
</alsTreeLikelihood>

<aminoAcidModel> element

An empirical amino acid substitution model.

The element takes following attributes:

  • type is of type String
    “The type of empirical amino-acid rate matrix”

The element has the following contents:

  • Element named <frequencies>
    If the frequencies are omitted than the empirical frequencies associated with the selected model are used.

    Containing:

Example:

<aminoAcidModel type="blosum62"/>

<ancestralTrait> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic primarily for the purposes of logging”
  • traitName (optional) is of type String
    “The name of the trait to log”

The element has the following contents:

  • TreeModel element (exactly one)

  • TreeTraitProvider element (exactly one)

  • Element named <mrca>
    The MRCA to reconstruct the trait at (default root node)

    Containing:

    • Taxa element (exactly one)

Example:

<ancestralTrait name="foo" traitName="foo">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <partitionedTreeModel idref="partitionedTreeModel6">
  </empiricalTreeDistributionModel>
  <attributeBranchRateModel rateAttribute="foo">
    <treeModel idref="treeModel6">
  </attributeBranchRateModel>
</ancestralTrait>

<ancestralTrait> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic primarily for the purposes of logging”
  • traitName (optional) is of type String
    “The name of the trait to log”

The element has the following contents:

  • TreeModel element (exactly one)

  • TreeTraitProvider element (exactly one)

  • Element named <mrca>
    The MRCA to reconstruct the trait at (default root node)

    Containing:

    • Taxa element (exactly one)

Example:

<ancestralTrait name="foo" traitName="foo">
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork9">
    <rootHeight>
      <sumParameter idref="sumParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter2">
    </nodeHeights>
    <leafHeight taxon="foo">
      <diagonalMatrix idref="diagonalMatrix1">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix6">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundParameter idref="compoundParameter9">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter2">
    </leafTrait>
  </treeModel>
  <randomLocalYuleModel ratesAsMultipliers="true" dp="1" units="days">
    <birthRates>
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </birthRates>
    <indicators>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    </indicators>
    <meanRate>
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </meanRate>
  </randomLocalYuleModel>
</ancestralTrait>

<ancestralTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

  • useAmbiguities (optional) is of type Boolean
  • stateTagName (optional) is of type String
  • scalingScheme (optional) is of type String
  • delayScaling (optional) is of type String

The element has the following contents:

Example:

<ancestralTreeLikelihood useAmbiguities="true" stateTagName="foo" scalingScheme="foo" delayScaling="foo">
  <convert dataType="nucleotide">
    <sequenceSimulator idref="sequenceSimulator2">
  </convert>
  <treeModel fixHeights="true" fixTree="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
    <rootHeight>
      <productParameter idref="productParameter4">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips7">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <differenceParameter idref="differenceParameter4">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter1">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <parameter idref="parameter10">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter5">
    </leafTrait>
  </treeModel>
  <siteModel>
    <relativeRate weight="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </relativeRate>
  </siteModel>
</ancestralTreeLikelihood>

<antigenicDriftPrior> element

Provides the likelihood of a vector of coordinates in some multidimensional ‘antigenic’ space based on an expected relationship with time.

The element has the following contents:

  • Element named <locations>

    Containing:

  • Element named <offsets>

    Containing:

  • Element named <regressionSlope>

    Containing:

  • Element named <regressionPrecision>

    Containing:

Example:

<antigenicDriftPrior>
  <locations>
    <compoundMatrixParameter idref="compoundMatrixParameter2">
  </locations>
  <offsets>
    <differenceMatrixParameter idref="differenceMatrixParameter4">
  </offsets>
  <regressionSlope>
    <matrixParameter idref="matrixParameter9">
  </regressionSlope>
  <regressionPrecision>
    <compoundParameter idref="compoundParameter5">
  </regressionPrecision>
</antigenicDriftPrior>

<antigenicLikelihood> element

Provides the likelihood of immunological assay data such as Hemagglutinin inhibition (HI) given vectors of coordinatesfor viruses and sera/antisera in some multidimensional ‘antigenic’ space.

The element takes following attributes:

  • fileName is of type String
    “The name of the file containing the assay table”
  • mdsDimension is of type Integer
    “The dimension of the space for MDS”
  • mergeSerumIsolates (optional) is of type Boolean
    “Should multiple serum isolates from the same strain have their locations merged (defaults to false)”
  • intervalWidth (optional) is of type Double
    “The width of the titre interval in log 2 space”
  • driftInitialLocations (optional) is of type Double
    “The degree to drift initial virus and serum locations, defaults to 0.0”

The element has the following contents:

  • Element named <tipTrait>
    Optional parameter of tip locations from the tree

    Containing:

  • Element named <virusLocations>
    Parameter of locations of all virus

    Containing:

  • Element named <serumLocations>
    Parameter of locations of all sera

    Containing:

  • Element named <virusOffsets>
    Optional parameter for virus dates to be stored

    Containing:

  • Element named <serumOffsets>
    Optional parameter for serum dates to be stored

    Containing:

  • Element named <serumPotencies>
    Optional parameter for serum potencies

    Containing:

  • Element named <serumBreadths>
    Optional parameter for serum breadths

    Containing:

  • Element named <virusAvidities>
    Optional parameter for virus avidities

    Containing:

  • Element named <mdsPrecision>
    Parameter for precision of MDS embedding

    Containing:

  • Element named <locationDrift>
    Optional parameter for drifting locations with time

    Containing:

  • Element named <virusDrift>
    Optional parameter for drifting only virus locations, overrides locationDrift

    Containing:

  • Element named <serumDrift>
    Optional parameter for drifting only serum locations, overrides locationDrift

    Containing:

Example:

<antigenicLikelihood fileName="foo" mdsDimension="1" mergeSerumIsolates="true" intervalWidth="1.0" driftInitialLocations="1.0">
  <virusLocations>
    <mvPolyaLikelihood idref="mvPolyaLikelihood10">
  </virusLocations>
  <serumLocations>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
  </serumLocations>
  <mdsPrecision>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision7">
  </mdsPrecision>
</antigenicLikelihood>

<appendedPotentialDerivative> element

null

The element has the following contents:

Example:

<appendedPotentialDerivative>
  <gradient>
    <twoPartDistribution idref="twoPartDistribution6">
  </gradient>
  <sumDerivative>
    <sumDerivative idref="sumDerivative9">
    <sumDerivative idref="sumDerivative1">
    <gradient idref="gradient4">
    <gradient idref="gradient4">
  </sumDerivative>
  <sumDerivative>
    <appendedPotentialDerivative idref="appendedPotentialDerivative8">
  </sumDerivative>
  <maskedGradient>
    <sumDerivative idref="sumDerivative6">
    <mask>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser7">
    </mask>
  </maskedGradient>
</appendedPotentialDerivative>

<approximateFactorAnalysisPrecision> element

A diffusion approximation to a factor analysis

The element has the following contents:

Example:

<approximateFactorAnalysisPrecision>
  <L>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser3">
  </L>
  <gamma>
    <sumParameter idref="sumParameter5">
  </gamma>
</approximateFactorAnalysisPrecision>

<apsp> element

A diploid or allopolyploid species made of individuals

The element takes following attributes:

  • ploidylevel is of type Double

The element has the following contents:

Example:

<apsp ploidylevel="1.0">
  <individual>
    <apsp idref="apsp2">
  </individual>
</apsp>

<apspCoalescent> element

Likelihood of a set of gene trees embedded in a allopolyploid species network.

The element has the following contents:

Example:

<apspCoalescent>
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp3">
    <apsp idref="apsp3">
    <apsp idref="apsp8">
    <apsp idref="apsp8">
    <geneTrees>
      <starTreeModel idref="starTreeModel7">
      <starTreeModel idref="starTreeModel8">
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
      </gtree>
      <gtree popfactor="1.0">
        <partitionedTreeModel idref="partitionedTreeModel10">
      </gtree>
      <gtree popfactor="1.0">
        <starTreeModel idref="starTreeModel10">
      </gtree>
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies3">
    <tipPopulations value="1.0">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser7">
    </tipPopulations>
    <rootPopulations value="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter7">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <fastMatrixParameter idref="fastMatrixParameter3">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</apspCoalescent>

<apspNetworkPrior> element

Prior for an allopolyploid species network.

The element has the following contents:

Example:

<apspNetworkPrior>
  <model>
    <alloppNetworkPriorModel idref="alloppNetworkPriorModel2">
  </model>
  <apspNetwork>
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork7">
  </apspNetwork>
</apspNetworkPrior>

<arbitraryBranchRates> element

This element returns an arbitrary rate model.The branch rates are drawn from an arbitrary distribution determine by the prior.

The element takes following attributes:

  • reciprocal (optional) is of type Boolean
  • centerAtOne (optional) is of type Boolean
  • exp (optional) is of type Boolean

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <rates>
    The rate parameter

    Containing:

Example:

<arbitraryBranchRates reciprocal="true" centerAtOne="true" exp="true">
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork5">
    <rootHeight>
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <complementParameter idref="complementParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <sumParameter idref="sumParameter8">
    </nodeHeights>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastMatrixParameter idref="fastMatrixParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceParameter idref="differenceParameter9">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter5">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <designMatrix idref="designMatrix9">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix7">
    </leafTrait>
  </treeModel>
  <rates>
    <dataFromTreeTips idref="dataFromTreeTips4">
  </rates>
</arbitraryBranchRates>

<argCoalescentLikelihood> element

A coalescent likelihood for an ARG model

The element takes following attributes:

  • ancestralRestriction (optional) is of type Boolean

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <recombinationRate>

    Containing:

  • Element named <argModel>

    Containing:

Example:

<argCoalescentLikelihood ancestralRestriction="true">
  <populationSize>
    <jointParameter idref="jointParameter8">
  </populationSize>
  <recombinationRate>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
  </recombinationRate>
  <argModel>
    <argTreeModel idref="argTreeModel2">
  </argModel>
</argCoalescentLikelihood>

<argDiscretizedBranchRates> element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.

The element takes following attributes:

  • numRateCategories is of type Integer

The element has the following contents:

Example:

<argDiscretizedBranchRates numRateCategories="1">
  <argTreeModel partitionType="recombination">
    <newick idref="newick9">
    <rootHeight>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <fastMatrixParameter idref="fastMatrixParameter5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter5">
    </nodeHeights>
  </argTreeModel>
  <distribution>
    <uniformDistributionModel idref="uniformDistributionModel10">
  </distribution>
</argDiscretizedBranchRates>

<ARGEventOperator> element

An operator that slides a subarg.

The element takes following attributes:

  • addProbability is of type Double
    “The probability that the operator adds a new reassortment event”
  • jointPartitioning (optional) is of type Boolean
  • tossSize (optional) is of type Integer
  • addProbability (optional) is of type Double
  • autoOptimize (optional) is of type Boolean
  • weight is of type Integer

The element has the following contents:

Example:

<ARGEventOperator addProbability="1.0" jointPartitioning="true" tossSize="1" addProbability="1.0" autoOptimize="true" weight="1">
  <argTreeModel partitionType="recombination">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
    <rootHeight>
      <sumParameter idref="sumParameter6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix1">
    </nodeHeights>
  </argTreeModel>
  <poissonPartitionLikelihood mean="1.0">
    <argTreeModel idref="argTreeModel5">
  </poissonPartitionLikelihood>
  <internalNodes>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser9">
  </internalNodes>
  <internalNodesPlusRoot>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView8">
  </internalNodesPlusRoot>
  <nodeRates>
    <matrixParameter idref="matrixParameter5">
  </nodeRates>
</ARGEventOperator>

<argLocalClock> element

null

Example:

<argLocalClock/>

<argTreeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.

The element takes following attributes:

  • partitionType (optional) is of type String
    “Describes the partition structure of the model”

The element has the following contents:

  • Tree element (exactly one)

  • Element named <rootHeight>
    A parameter definition with id only (cannot be a reference!)

    Containing:

  • Element named <nodeHeights>

    Containing:

    • rootNode (optional) is of type Boolean
      “If true the root height is included in the parameter”
    • internalNodes (optional) is of type Boolean
      “If true the internal node heights (minus the root) are included in the parameter”
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)

Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>```



### <code>&lt;argNarrowExchange&gt;</code> element

This element represents a narrow exchange operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

* <code>weight</code>  is of type [Integer](#integer)
: 

The element has the following contents:

* [ARGModel](#argmodel) element (exactly one)

Example:

```html
<argNarrowExchange weight="1">
  <argTreeModel partitionType="recombination">
    <tree idref="tree8">
    <rootHeight>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    </nodeHeights>
  </argTreeModel>
</argNarrowExchange>

<argPartitionOperator> element

An operator that picks a new partitioning uniformly at random.

The element takes following attributes:

The element has the following contents:

Example:

<argPartitionOperator weight="1" tossSize="1" tossAll="true">
  <argTreeModel partitionType="recombination">
    <speciesTree idref="speciesTree3">
    <rootHeight>
      <fastMatrixParameter idref="fastMatrixParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
    </nodeHeights>
  </argTreeModel>
</argPartitionOperator>

<argRatePrior> element

null

Example:

<argRatePrior/>

<argReassortmentNodeCount> element

A statistic that returns the number of reassortment nodes in an ARG

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic for the purpose of logging”

The element has the following contents:

Example:

<argReassortmentNodeCount name="foo">
  <argTreeModel partitionType="recombination">
    <argTreeModel idref="argTreeModel6">
    <rootHeight>
      <leafTraitParameter idref="leafTraitParameter5">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </nodeHeights>
  </argTreeModel>
</argReassortmentNodeCount>

<argSubtreeSlide> element

An operator that slides a subtree.

The element takes following attributes:

The element has the following contents:

Example:

<argSubtreeSlide weight="1" size="1.0" gaussian="true" swapRates="true" swapTraits="true" autoOptimize="true">
  <argTreeModel partitionType="recombination">
    <speciesTree idref="speciesTree4">
    <rootHeight>
      <mvPolyaLikelihood idref="mvPolyaLikelihood2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter6">
    </nodeHeights>
  </argTreeModel>
</argSubtreeSlide>

<argSwapOperator> element

Swaps nodes on a tree

The element takes following attributes:

  • weight is of type Integer
  • type is of type String
    “The mode of the operator”

The element has the following contents:

Example:

<argSwapOperator weight="1" type="narrowSwap">
  <argTreeModel partitionType="recombination">
    <rescaledTree idref="rescaledTree4">
    <rootHeight>
      <copyParameterValues idref="copyParameterValues9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <differenceMatrixParameter idref="differenceMatrixParameter5">
    </nodeHeights>
  </argTreeModel>
</argSwapOperator>

<argTimingStatistic> element

The element takes following attributes:

  • name (optional) is of type String

The element has the following contents:

Example:

<argTimingStatistic name="foo">
  <argTreeModel partitionType="recombination">
    <mulSpeciesTree idref="mulSpeciesTree9">
    <rootHeight>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips5">
    </nodeHeights>
  </argTreeModel>
</argTimingStatistic>

<argTotalLengthStatistic> element

null

Example:

<argTotalLengthStatistic/>

<argTraceAnalysis> element

Analyses and reports on a trace consisting of trees.

The element takes following attributes:

  • fileName is of type String
    “name of a tree log file”
  • burnIn (optional) is of type Integer

Example:

<argTraceAnalysis fileName="trees.log" burnIn="1"/>

<argTreeCount> element

Provides number of distinct loci trees

The element has the following contents:

Example:

<argTreeCount>
  <argTreeModel partitionType="recombination">
    <newick idref="newick7">
    <rootHeight>
      <complementParameter idref="complementParameter7">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    </nodeHeights>
  </argTreeModel>
</argTreeCount>

<argTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

  • useAmbiguities (optional) is of type Boolean
  • storePartials (optional) is of type Boolean
  • useScaling (optional) is of type Boolean

The element has the following contents:

Example:

<argTreeLikelihood useAmbiguities="true" storePartials="true" useScaling="true">
  <ascertainedPatterns from="1" to="1" every="1">
    <sequenceSimulator idref="sequenceSimulator5">
  </ascertainedPatterns>
  <argTreeModel partitionType="reassortment">
    <speciesTree idref="speciesTree5">
    <rootHeight>
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter1">
    </nodeHeights>
  </argTreeModel>
  ERROR!
</argTreeLikelihood>

<argTreeModel> element

This element represents a model of the tree. The tree model includes and attributes of the nodes including the age (or height) and the rate of evolution at each node in the tree.

The element takes following attributes:

  • partitionType (optional) is of type String
    “Describes the partition structure of the model”

The element has the following contents:

  • Tree element (exactly one)

  • Element named <rootHeight>
    A parameter definition with id only (cannot be a reference!)

    Containing:

  • Element named <nodeHeights>

    Containing:

    • rootNode (optional) is of type Boolean
      “If true the root height is included in the parameter”
    • internalNodes (optional) is of type Boolean
      “If true the internal node heights (minus the root) are included in the parameter”
    • Parameter element (exactly one)
      A parameter definition with id only (cannot be a reference!)

Example:

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>```



### <code>&lt;argUniformPrior&gt;</code> element

A uniform prior for an ARG model

The element has the following contents:

* [ARGModel](#argmodel) element (exactly one)

Example:

```html
<argUniformPrior>
  <argTreeModel partitionType="reassortment">
    <argTreeModel idref="argTreeModel5">
    <rootHeight>
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <parameter idref="parameter5">
    </nodeHeights>
  </argTreeModel>
</argUniformPrior>

<argWideExchange> element

This element represents a wide exchange operator. This operator swaps two random subtrees.

The element takes following attributes:

The element has the following contents:

Example:

<argWideExchange weight="1">
  <argTreeModel partitionType="reassortment">
    <speciesTree idref="speciesTree6">
    <rootHeight>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice6">
    </nodeHeights>
  </argTreeModel>
</argWideExchange>

<arithmeticMeanAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

  • fileName is of type String
    “The traceName of a BEAST log file (can not include trees, which should be logged separately”
  • burnIn (optional) is of type Integer
  • bootstrapLength (optional) is of type Integer

The element has the following contents:

  • Element named <likelihoodColumn>

    Containing:

    • name is of type String
      “The column name”

Example:

<arithmeticMeanAnalysis fileName="foo" burnIn="1" bootstrapLength="1">
  <likelihoodColumn name="foo"/>
</arithmeticMeanAnalysis>

<array> element

This element returns an array of the objects it contains.

The element has the following contents:

  • Object elements (one or more)
    Objects to be put in an array

Example:

<array>
  <hiddenNucleotides classCount="1"/>
  <precisionGibbsOperator weight="1.0">
    <treeTraitNormalDistributionLikelihood idref="treeTraitNormalDistributionLikelihood2">
  </precisionGibbsOperator>
</array>

<ascertainedPatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element takes following attributes:

  • from (optional) is of type Integer
    “The site position to start at, default is 1 (the first position)”
  • to (optional) is of type Integer
    “The site position to finish at, must be greater than from, default is length of given alignment”
  • every (optional) is of type Integer
    “Determines how many sites are selected. A value of 3 will select every third site starting from from, default is 1 (every site)”

The element has the following contents:

  • Element named <taxonList>

    Containing:

  • Alignment element (exactly one)

:

Example:

<ascertainedPatterns from="1" to="1" every="1">
  <alignment>
    <kStateType idref="kStateType2">
    <sequence idref="sequence8">
    <sequence idref="sequence3">
    <sequence idref="sequence5">
    <sequence idref="sequence8">
  </alignment>
</ascertainedPatterns>

<attr> element

This element represents a name/value pair.

The element takes following attributes:

  • name is of type String
    “The name to give to this attribute”

The element has the following contents:

  • Object element (exactly one)

Example:

<attr name="foo">
  <mulSpeciesTree constantRoot="true" constantPopulation="true">
    <mulSpecies idref="mulSpecies4">
    <sppSplitPopulations value="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    </sppSplitPopulations>
  </mulSpeciesTree>
</attr>

<attributeBranchRateModel> element

This element returns a branch rate model.The branch rates are specified by an attribute embedded in the nodes of the tree.

The element takes following attributes:

  • rateAttribute is of type String
    “Optional name of a rate attribute to be read with the trees”

The element has the following contents:

Example:

<attributeBranchRateModel rateAttribute="foo">
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork1">
    <rootHeight>
      <copyParameterValues idref="copyParameterValues5">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter4">
    </nodeHeights>
    <leafHeight taxon="foo">
      <compoundMatrixParameter idref="compoundMatrixParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <sumParameter idref="sumParameter5">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixMatrixProduct idref="matrixMatrixProduct4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix1">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <duplicatedParameter idref="duplicatedParameter2">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixMatrixProduct idref="matrixMatrixProduct10">
    </nodeTraits>
    <leafTrait taxon="foo" name="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix7">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <designMatrix idref="designMatrix8">
    </leafTrait>
  </treeModel>
</attributeBranchRateModel>

<attributePatterns> element

A site pattern defined by an attribute in a set of taxa.

The element takes following attributes:

  • attribute is of type String
  • secondary (optional) is of type String

The element has the following contents:

  • One of:
    • dataType is of type String
      “The data type”
    • DataType element (exactly one)
  • TaxonList element (exactly one)
    The taxon set

Example:

<attributePatterns dataType="hiddenAminoAcid2" attribute="foo" secondary="foo">
  <hypermutantAlignment type="both">
    <sequenceSimulator idref="sequenceSimulator7">
  </hypermutantAlignment>
</attributePatterns>

<attributes> element

This element represents an array of name/value pairs.

The element takes following attributes:

Example:

<attributes names="foo bar" values="foo bar"/>

<bdcNClustersStatistic> element

Statistic for number of collapsed nodes in species tree when using birth-death-collapse model.

The element takes following attributes:

The element has the following contents:

Example:

<bdcNClustersStatistic name="foo">
  <speciesTree>
    <speciesTree idref="speciesTree6">
  </speciesTree>
  <collapseModel>
    <birthDeathCollapseModel idref="birthDeathCollapseModel8">
  </collapseModel>
</bdcNClustersStatistic>

<beagleBranchLikelihood> element

beagleBranchLikelihood

Example:

<beagleBranchLikelihood/>

<beagleOperationReport> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

  • branchFileName (optional) is of type String
  • operationFileName (optional) is of type String

The element has the following contents:

Example:

<beagleOperationReport branchFileName="foo" operationFileName="foo">
  <maskedPatterns negative="true">
    <alignment idref="alignment9">
    <mask>
      foo
    </mask>
  </maskedPatterns>
  <convert dataType="nucleotide">
    <alignment idref="alignment2">
  </convert>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <patterns idref="patterns6">
  </empiricalTreeDistributionModel>
  <epochBranchModel>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5">
    <empiricalCodonModel idref="empiricalCodonModel2">
    <epoch transitionTime="1.0">
      <binaryCovarionModel idref="binaryCovarionModel1">
    </epoch>
    <epoch transitionTime="1.0">
      <complexSubstitutionModel idref="complexSubstitutionModel4">
    </epoch>
    <epoch transitionTime="1.0">
      <binarySubstitutionModel idref="binarySubstitutionModel7">
    </epoch>
    <epoch transitionTime="1.0">
      <museGautCodonModel idref="museGautCodonModel5">
    </epoch>
  </epochBranchModel>
  <siteModel>
    <relativeRate weight="1.0">
      <leafTraitParameter idref="leafTraitParameter10">
    </relativeRate>
  </siteModel>
</beagleOperationReport>

<benchmarker> element

This element runs a benchmark on a series of likelihood calculators.

The element takes following attributes:

  • iterationCount is of type Integer

The element has the following contents:

Example:

<benchmarker iterationCount="1">
  <empiricalDistributionLikelihood fileName="foo" splineInterpolation="true" degree="1" inverse="true" readByColumn="true">
    <data from="1" to="1" offset="1.0" lower="1.0" upper="1.0">
      <partitionStatistic idref="partitionStatistic3">
      <treeMetricStatistic idref="treeMetricStatistic10">
      <statistic idref="statistic3">
      <argTotalLengthStatistic idref="argTotalLengthStatistic5">
    </data>
  </empiricalDistributionLikelihood>
  <modelSpecificPseudoPrior/>
</benchmarker>

<betaDistributionModel> element

A model of a beta distribution.

The element has the following contents:

  • One of:
    • Element named <alpha>

      Containing:

      • Double element (exactly one)
    • Element named <alpha>

      Containing:

  • One of:
    • Element named <beta>

      Containing:

      • Double element (exactly one)
    • Element named <beta>

      Containing:

Example:

<betaDistributionModel>
  <alpha>
    <parameter idref="parameter6">
  </alpha>
  <beta>
    1.0
  </beta>
</betaDistributionModel>

<betaPrior> element

Calculates the prior probability of some data under a given beta distribution.

The element takes following attributes:

The element has the following contents:

Example:

<betaPrior shape="1.0" shapeB="1.0" offset="1.0">
  <correlation dimension1="1" dimension2="1">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
  </correlation>
</betaPrior>

<betaSplittingModel> element

The beta-splitting family of tree branching models (Aldous, 1996;2001).

The element has the following contents:

  • Element named <phi>
    A parameter that ranges from -infinity (comb-tree) to +infinity (balanced tree)

    Containing:

  • Element named <branchingTree>

    Containing:

    • Tree element (exactly one)

Example:

<betaSplittingModel>
  <phi>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
  </phi>
  <branchingTree>
    <newick idref="newick8">
  </branchingTree>
</betaSplittingModel>

<biasedMultivariateDiffusionModel> element

Describes a multivariate normal diffusion process.

The element has the following contents:

  • Element named <precisionMatrix>

    Containing:

  • Element named <biasParameter>

    Containing:

Example:

<biasedMultivariateDiffusionModel>
  <precisionMatrix>
    <diagonalMatrix idref="diagonalMatrix1">
  </precisionMatrix>
  <biasParameter>
    <complementParameter idref="complementParameter2">
  </biasParameter>
</biasedMultivariateDiffusionModel>

<bifractionalDiffusionModel> element

Describes a bivariate diffusion process using a bifractional random walk

The element has the following contents:

  • Element named <alpha>

    Containing:

  • Element named <beta>

    Containing:

Example:

<bifractionalDiffusionModel>
  <alpha>
    <maskedMatrixParameter idref="maskedMatrixParameter1">
  </alpha>
  <beta>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
  </beta>
</bifractionalDiffusionModel>

<binaryCovarionModel> element

A covarion substitution model on binary data and a hidden rate state with two rates.

The element takes following attributes:

  • version (optional) is of type String

The element has the following contents:

  • Element named <frequencies>

    Containing:

  • Element named <hiddenFrequencies>

    Containing:

  • Element named <alpha>

    Containing:

  • Element named <switchingRate>

    Containing:

Example:

<binaryCovarionModel version="foo">
  <frequencies>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix10">
  </frequencies>
  <hiddenFrequencies>
    <diagonalMatrix idref="diagonalMatrix4">
  </hiddenFrequencies>
  <alpha/>
  <switchingRate/>
</binaryCovarionModel>

<binarySubstitutionModel> element

A general reversible model of sequence substitution for binary data type.

The element has the following contents:

  • Element named <frequencies>

    Containing:

Example:

<binarySubstitutionModel>
  <frequencies>
    <frequencyModel idref="frequencyModel2">
  </frequencies>
</binarySubstitutionModel>

<binomialLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element takes following attributes:

  • onLogitScale (optional) is of type Boolean

The element has the following contents:

  • Element named <counts>

    Containing:

  • Element named <proportion>

    Containing:

  • One of:

    • Element named <trials>

      Containing:

    • Element named <trials>

      Containing:

Example:

<binomialLikelihood onLogitScale="true">
  <counts>
    <copyParameterValues idref="copyParameterValues9">
  </counts>
  <proportion>
    <complementParameter idref="complementParameter10">
  </proportion>
  <trials values="1 2 4 8"/>
</binomialLikelihood>

<birthDeathCollapseModel> element

A speciation model aimed at species delimitation, mixing birth-death model with spike near zero for node heights.

The element takes following attributes:

  • units is of type String
    “the units”
  • collapseHeight is of type Double

The element has the following contents:

  • Element named <speciesTree>

    Containing:

    • Tree element (exactly one)
  • Element named <birthMinusDeathRate>

    Containing:

  • Element named <relativeDeathRate>

    Containing:

  • Element named <originHeight>

    Containing:

  • Element named <collapseWeight>

    Containing:

Example:

<birthDeathCollapseModel units="months" collapseHeight="1.0">
  <speciesTree>
    <argTreeModel idref="argTreeModel8">
  </speciesTree>
  <birthMinusDeathRate>
    <maskedParameter idref="maskedParameter8">
  </birthMinusDeathRate>
  <relativeDeathRate>
    <vectorSlice idref="vectorSlice6">
  </relativeDeathRate>
  <originHeight>
    <fastMatrixParameter idref="fastMatrixParameter6">
  </originHeight>
  <collapseWeight>
    <immutableParameter idref="immutableParameter5">
  </collapseWeight>
</birthDeathCollapseModel>

<birthDeathEpidemiology> element

Stadler et al (2011) model of epidemiology.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <origin>
    The origin of the infection, x0 > tree.rootHeight

    Containing:

  • Element named <R0>

    Containing:

  • Element named <recoveryRate>

    Containing:

  • Element named <samplingProbability>

    Containing:

Example:

<birthDeathEpidemiology units="days">
  <R0>
    <immutableParameter idref="immutableParameter7">
  </R0>
  <recoveryRate>
    <mvPolyaLikelihood idref="mvPolyaLikelihood2">
  </recoveryRate>
  <samplingProbability>
    <dataFromTreeTips idref="dataFromTreeTips4">
  </samplingProbability>
</birthDeathEpidemiology>

<birthDeathModel> element

Gernhard (2008) model of speciation (equation at bottom of page 19 of draft).

The element takes following attributes:

  • type (optional) is of type String
  • conditionalOnRoot (optional) is of type Boolean
  • units is of type String
    “the units”

The element has the following contents:

  • Element named <birthMinusDeathRate>

    Containing:

  • Element named <relativeDeathRate>

    Containing:

  • Element named <sampleProbability>

    Containing:

Example:

<birthDeathModel type="foo" conditionalOnRoot="true" units="years">
  <birthMinusDeathRate>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView6">
  </birthMinusDeathRate>
  <relativeDeathRate>
    <differenceParameter idref="differenceParameter2">
  </relativeDeathRate>
</birthDeathModel>

<birthDeathSerialSampling> element

Stadler et al (2010) model of speciation.

The element takes following attributes:

  • type (optional) is of type String
  • hasFinalSample (optional) is of type Boolean

The element has the following contents:

  • Element named <origin>
    The origin of the infection, x0 > tree.rootHeight

    Containing:

  • Element named <birthRate>

    Containing:

  • One of:
    • Element named <deathRate>

      Containing:

    • Element named <relativeDeathRate>

      Containing:

  • Element named <psi>

    Containing:

  • Element named <sampleBecomesNonInfectiousProb>

    Containing:

Example:

<birthDeathSerialSampling type="foo" hasFinalSample="true">
  <birthRate>
    <copyParameterValues idref="copyParameterValues1">
  </birthRate>
  <deathRate>
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
  </deathRate>
  <psi>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView7">
  </psi>
</birthDeathSerialSampling>

<bitFlipInSubstitutionModelOperator> element

This element returns a bit-flip operator on a given indicatorParameter.

The element takes following attributes:

  • weight is of type Double
  • scaleFactor is of type Double
  • autoOptimize (optional) is of type Boolean

The element has the following contents:

Example:

<bitFlipInSubstitutionModelOperator weight="1.0" scaleFactor="1.0" autoOptimize="true">
  <complexSubstitutionModel randomizeIndicator="true" bssvsTolerance="1.0" bssvsScalar="1.0" checkConditioning="true" normalized="true">
    <microsatellite idref="microsatellite2">
    <frequencies>
      <frequencyModel idref="frequencyModel9">
    </frequencies>
    <rates/>
  </complexSubstitutionModel>
</bitFlipInSubstitutionModelOperator>

<bitFlipOperator> element

This element returns a bit-flip operator on a given parameter.

The element takes following attributes:

  • weight is of type Double
  • usesPriorOnSum (optional) is of type Boolean

The element has the following contents:

Example:

<bitFlipOperator weight="1.0" usesPriorOnSum="true">
  <maskedParameter complement="true" build="true" from="1" to="1" every="1">
    <compoundParameter idref="compoundParameter4">
  </maskedParameter>
</bitFlipOperator>

<bitMoveOperator> element

This element returns a bit-move operator on a given parameter.

The element takes following attributes:

The element has the following contents:

  • Element named <bits>

    Containing:

  • Element named <values>
    values parameter

    Containing:

Example:

<bitMoveOperator weight="1.0" numBitsToMove="1">
  <bits>
    <leafTraitParameter idref="leafTraitParameter3">
  </bits>
</bitMoveOperator>

<bitSwapOperator> element

This element returns a bit-swap operator on a given parameter and data.

The element takes following attributes:

  • weight is of type Double
  • radius (optional) is of type Double

The element has the following contents:

  • Element named <data>

    Containing:

  • Element named <indicators>

    Containing:

Example:

<bitSwapOperator weight="1.0" radius="1.0">
  <data>
    <continuousDiffusionStatistic idref="continuousDiffusionStatistic8">
  </data>
  <indicators>
    <driftedLocationsStatistic idref="driftedLocationsStatistic1">
  </indicators>
</bitSwapOperator>

<blockUpperTriangularMatrixParameter> element

Returns a blockUpperTriangularMatrixParameter which is a compoundParameter which forces the last element to be of full length, the second to last element to be of full length-1, etc.

The element takes following attributes:

  • transpose (optional) is of type Boolean
  • columnDimension (optional) is of type Integer
  • diagonalRestriction (optional) is of type Boolean

The element has the following contents:

Example:

<blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true">
  <diagonalMatrix>
    <copyParameterValues idref="copyParameterValues10">
  </diagonalMatrix>
  <markovRandomFieldMatrix asCorrelation="true" dim="1">
    <diagonal>
      <differenceParameter idref="differenceParameter6">
    </diagonal>
    <offDiagonal>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix1">
    </offDiagonal>
    <nugget>
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </nugget>
  </markovRandomFieldMatrix>
  <mvPolyaLikelihood>
    <data>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </data>
    <frequencies>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
    </frequencies>
  </mvPolyaLikelihood>
  <duplicatedParameter>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    <copies>
      <designMatrix idref="designMatrix3">
    </copies>
  </duplicatedParameter>
</blockUpperTriangularMatrixParameter>

<booleanLikelihood> element

A function that log likelihood of a set of boolean statistics. If all the statistics are true then it returns 0.0 otherwise -infinity.

The element has the following contents:

Example:

<booleanLikelihood>
  <monophylyStatistic name="foo" inverse="true">
    <upgmaTree idref="upgmaTree3">
    <mrca>
      <taxa idref="taxa3">
    </mrca>
  </monophylyStatistic>
  <notBooleanStatistic>
    <monophylyStatistic idref="monophylyStatistic3">
  </notBooleanStatistic>
  <compatibilityStatistic name="foo">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork8">
    <compatibleWith>
      <transformedTreeModel idref="transformedTreeModel10">
    </compatibleWith>
    <neighborJoiningTree idref="neighborJoiningTree9">
  </compatibilityStatistic>
</booleanLikelihood>

<branchAssignmentModel> element

This element provides a branch model which assigns substitution models to branches on the tree

The element has the following contents:

Example:

<branchAssignmentModel>
  <treeModel fixHeights="true" fixTree="true">
    <upgmaTree idref="upgmaTree1">
    <rootHeight>
      <matrixMatrixProduct idref="matrixMatrixProduct7">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix2">
    </nodeHeights>
    <leafHeight taxon="foo">
      <dataFromTreeTips idref="dataFromTreeTips8">
    </leafHeight>
    <leafHeight taxon="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix10">
    </leafHeight>
    <leafHeight taxon="foo">
      <differenceParameter idref="differenceParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <mvPolyaLikelihood idref="mvPolyaLikelihood10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundMatrixParameter idref="compoundMatrixParameter2">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <complementParameter idref="complementParameter3">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix8">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <duplicatedParameter idref="duplicatedParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter9">
    </leafTrait>
  </treeModel>
  <assignment annotationValue="1">
    <hkyModel idref="hkyModel9">
  </assignment>
  <assignment annotationValue="1">
    <markovModulatedSubstitutionModel idref="markovModulatedSubstitutionModel9">
  </assignment>
  <assignment annotationValue="1">
    <markovModulatedYangCodonModel idref="markovModulatedYangCodonModel10">
  </assignment>
  <assignment annotationValue="1">
    <glmSubstitutionModelNew idref="glmSubstitutionModelNew3">
  </assignment>
  <baseModel>
    <TN93Model idref="TN93Model4">
  </baseModel>
</branchAssignmentModel>

<branchCategories> element

This element provides a set of branch categories.

The element takes following attributes:

  • randomize (optional) is of type Boolean

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <rateCategories>
    Allocation parameter

    Containing:

  • Element named <clade>

    Containing:

    • category is of type Integer
    • includeStem (optional) is of type Boolean
      “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
    • excludeClade (optional) is of type Boolean
      “determines whether to exclude actual branches of the clade from the siteModel (default false).”
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to
  • Element named <trunk>

    Containing:

    • category is of type Integer
    • includeStem (optional) is of type Boolean
      “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
    • excludeClade (optional) is of type Boolean
      “determines whether to exclude actual branches of the clade from the siteModel (default false).”
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to

Example:

<branchCategories randomize="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <ascertainedPatterns idref="ascertainedPatterns1">
  </empiricalTreeDistributionModel>
  <rateCategories>
    <vectorSlice idref="vectorSlice8">
  </rateCategories>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa3">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa2">
  </clade>
  <trunk category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa9">
  </trunk>
</branchCategories>

<branchDirections> element

null

The element has the following contents:

Example:

<branchDirections>
  ERROR!
</branchDirections>

<branchingLikelihood> element

This element represents the likelihood of the tree given the demographic function.

The element has the following contents:

  • Element named <model>

    Containing:

  • Element named <branchingTree>

    Containing:

Example:

<branchingLikelihood>
  <model>
    <betaSplittingModel idref="betaSplittingModel4">
  </model>
  <branchingTree>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
  </branchingTree>
</branchingLikelihood>

<branchMagnitudes> element

null

The element takes following attributes:

  • scaleByLength (optional) is of type Boolean

The element has the following contents:

Example:

<branchMagnitudes scaleByLength="true">
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <immutableParameter idref="immutableParameter5">
    </traitParameter>
    <bifractionalDiffusionModel idref="bifractionalDiffusionModel9">
    <starTreeModel idref="starTreeModel1">
    ERROR!
    ERROR!
  </multivariateTraitLikelihood>
</branchMagnitudes>

<branchSpecificSubstitutionModel> element

This element provides a branch model which allows different substitution modelson different parts of the tree.

The element has the following contents:

  • TreeModel element (exactly one)
    The tree
  • SubstitutionModel element (exactly one)
    The substitution model for branches not explicitly included
  • Element named <externalBranches>

    Containing:

    • Taxa element (exactly one)
      A substitution model will be applied to the external branches for these taxa
    • SubstitutionModel element (exactly one)
      The substitution model
  • Element named <clade>

    Containing:

    • stemWeight (optional) is of type Double
      “What proportion of the stem branch to include [0 <= w <= 1] (default 0).”
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to
    • SubstitutionModel element (exactly one)
      The substitution model
  • Element named <backbone>

    Containing:

    • Taxa element (exactly one)
      A substitution model will be applied only to the ‘backbone’ branches defined by these taxa.
    • SubstitutionModel element (exactly one)
      The substitution model

Example:

<branchSpecificSubstitutionModel>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <mergePatterns idref="mergePatterns9">
  </empiricalTreeDistributionModel>
  <lewisMk totalOrder="true">
    <frequencies>
      <frequencyModel idref="frequencyModel2">
    </frequencies>
  </lewisMk>
  <backbone>
    <taxa idref="taxa6">
    <markovModulatedYangCodonModel idref="markovModulatedYangCodonModel7">
  </backbone>
  <backbone>
    <taxa idref="taxa6">
    <complexSubstitutionModel idref="complexSubstitutionModel5">
  </backbone>
  <backbone>
    <taxa idref="taxa9">
    <aminoAcidModel idref="aminoAcidModel1">
  </backbone>
</branchSpecificSubstitutionModel>

<branchSpecificTrait> element

branchSpecificTrait

The element has the following contents:

Example:

<branchSpecificTrait>
  <randomBranchModel rate="1.0">
    <starTreeModel idref="starTreeModel7">
    <baseSubstitutionModel>
      <gtrModel idref="gtrModel6">
    </baseSubstitutionModel>
  </randomBranchModel>
  <starTreeModel>
    <argTreeModel idref="argTreeModel7">
    <sharedRootHeight>
      <treeModel idref="treeModel8">
    </sharedRootHeight>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
    </leafHeight>
    <leafHeight taxon="foo">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </leafHeight>
  </starTreeModel>
</branchSpecificTrait>

<BrownianMotion> element

The element takes following attributes:

  • logUnits (optional) is of type Boolean

The element has the following contents:

Example:

<BrownianMotion logUnits="true">
  <sigma>
    1.0
  </sigma>
  <variableDemographic type="foo" logUnits="true" useMidpoints="true">
    <populationSizes>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
    </populationSizes>
    <indicators>
      <leafTraitParameter idref="leafTraitParameter4">
    </indicators>
    <trees>
      <ptree ploidy="1.0">
        <partitionedTreeModel idref="partitionedTreeModel6">
      </ptree>
    </trees>
  </variableDemographic>
</BrownianMotion>

<buildCompoundSymmetricMatrix> element

Returns a compound symmetric Matrix Parameter that is flexible, i.e. when exposed to a transition kernel can yield a result that is not compound symmetric

Example:

<buildCompoundSymmetricMatrix/>

<cachedPrior> element

Calculates a cached likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

Example:

<cachedPrior>
  <flatGeoSpatialPrior taxon="foo" inside="true" union="true" cache="true">
    <circle idref="circle10">
    <polygon idref="polygon3">
    <data>
      <duplicatedParameter idref="duplicatedParameter2">
      <differenceParameter idref="differenceParameter6">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter7">
      <complementParameter idref="complementParameter8">
    </data>
  </flatGeoSpatialPrior>
  <markovRandomFieldMatrix asCorrelation="true" dim="1">
    <diagonal>
      <designMatrix idref="designMatrix2">
    </diagonal>
    <offDiagonal>
      <differenceParameter idref="differenceParameter1">
    </offDiagonal>
    <nugget>
      <differenceParameter idref="differenceParameter4">
    </nugget>
  </markovRandomFieldMatrix>
</cachedPrior>

<cartogramDiffusionModel> element

Describes a bivariate diffusion process using cartogram distances.

The element takes following attributes:

  • cartogramFileName (optional) is of type String
  • xGridSize is of type Integer
  • yGridSize is of type Integer

The element has the following contents:

  • Parameter element (exactly one)

  • Element named <boundingBox>

    Containing:

Example:

<cartogramDiffusionModel cartogramFileName="foo" xGridSize="1" yGridSize="1">
  <designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
    <differenceParameter idref="differenceParameter3">
    <matrixParameter idref="matrixParameter4">
    <parameter idref="parameter10">
  </designMatrix>
  <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/>
</cartogramDiffusionModel>

<caseToCaseTransmissionLikelihood> element

This element represents a probability distribution for epidemiological parameters of an outbreakgiven a phylogenetic tree

The element has the following contents:

  • CaseToCaseTreeLikelihood element (exactly one)
    The tree likelihood
  • SpatialKernel element (zero or one)
    The spatial kernel
  • Element named <transmissionRate>
    The transmission rate

    Containing:

  • Element named <initialInfectionTimePrior>
    The prior probability distibution of the first infection

    Containing:

Example:

<caseToCaseTransmissionLikelihood>
  <withinCaseCoalescent truncate="true">
    <partitionedTreeModel idref="partitionedTreeModel5">
    <maxFirstInfToRoot>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
    </maxFirstInfToRoot>
    <demographicModel>
      <emergingEpidemic idref="emergingEpidemic10">
    </demographicModel>
  </withinCaseCoalescent>
  <transmissionRate>
    <diagonalMatrix idref="diagonalMatrix3">
  </transmissionRate>
</caseToCaseTransmissionLikelihood>

<cataclysm> element

A demographic model of exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <growthRate>
    The rate of exponential growth before the cataclysmic event.

    Containing:

  • One of:
    • Element named <spikeFactor>
      The factor larger the population size was at its height.

      Containing:

    • Element named <declineRate>

      Containing:

  • Element named <timeOfCataclysm>
    The time of the cataclysmic event that lead to exponential decline.

    Containing:

Example:

<cataclysm units="generations">
  <populationSize>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
  </populationSize>
  <growthRate>
    <matrixParameter idref="matrixParameter6">
  </growthRate>
  <declineRate>
    <differenceParameter idref="differenceParameter4">
  </declineRate>
  <timeOfCataclysm>
    <vectorSlice idref="vectorSlice7">
  </timeOfCataclysm>
</cataclysm>

<categoryOutbreak> element

Parses a set of ‘category’ farm outbreak and the information that they all share

The element takes following attributes:

  • hasLatentPeriods is of type String
    “Whether to include a latent period in the model”
  • hasGeography (optional) is of type Boolean

The element has the following contents:

  • ProductStatistic elements (zero to 2)

  • Element named <categoryCase>

    Containing:

    • wasEverInfected is of type Boolean
    • hostID is of type String
      “The unique identifier for this host”
    • endTime (optional) is of type String
      “The time of noninfectiousness of this host”
    • Taxon elements (zero or more)

    • Element named <infectionTimeBranchPosition>
      The exact position on the branch along which the infection of this case occurs that it actually does occur

      Containing:

    • Element named <spatialCoordinates>
      The spatial coordinates of this case

      Containing:

    • latentCategory (optional) is of type String
      “The category of latent period”
    • infectiousCategory (optional) is of type String
      “The category of infectious period”
    • indexPriorWeight (optional) is of type String
      “The weight of this case in the prior probabilty for theindex case”
  • Taxa element (exactly one)

  • Element named <infectiousPeriodPrior>
    A prior distribution for the length of infectious periods

    Containing:

  • Element named <latentPeriods>
    A prior distribution for the length of latent periods

    Containing:

  • Element named <distanceMatrix>
    A matrix of distances between the cases in this outbreak

    Containing:

Example:

<categoryOutbreak hasLatentPeriods="foo" hasGeography="true">
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
    <apsp idref="apsp10">
    <individual idref="individual5">
    <individual idref="individual7">
  </categoryCase>
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo"/>
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
    <apsp idref="apsp9">
    <taxon idref="taxon6">
    <sp idref="sp8">
    <taxon idref="taxon5">
  </categoryCase>
  <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
    <taxon idref="taxon3">
    <taxon idref="taxon10">
  </categoryCase>
  <taxa>
    <taxa idref="taxa3">
    <taxa idref="taxa8">
  </taxa>
  <infectiousPeriodPrior>
    <oneOverStDevPeriodPriorDistribution idref="oneOverStDevPeriodPriorDistribution4">
  </infectiousPeriodPrior>
  <infectiousPeriodPrior>
    <normalPeriodPriorDistribution idref="normalPeriodPriorDistribution1">
  </infectiousPeriodPrior>
  <infectiousPeriodPrior>
    <knownVarianceNormalPeriodPriorDistribution idref="knownVarianceNormalPeriodPriorDistribution3">
  </infectiousPeriodPrior>
  <infectiousPeriodPrior>
    <individualPrior idref="individualPrior3">
  </infectiousPeriodPrior>
  <latentPeriods>
    <leafTraitParameter idref="leafTraitParameter8">
  </latentPeriods>
  <latentPeriods>
    <copyParameterValues idref="copyParameterValues6">
  </latentPeriods>
</categoryOutbreak>

<centeredScale> element

A centered-scale operator. This operator scales the the values of a multi-dimensional parameter so as to perserve the mean. It does this by expanding or conrtacting the parameter values around the mean.

The element takes following attributes:

  • weight is of type Double
  • scaleFactor is of type Double
  • autoOptimize (optional) is of type Boolean

The element has the following contents:

Example:

<centeredScale weight="1.0" scaleFactor="1.0" autoOptimize="true">
  <differenceMatrixParameter/>
</centeredScale>

<changeNumHybridizations> element

Operator which changes the number of tetraploid subtrees (hybridizations) by merging and splitting them.

The element takes following attributes:

The element has the following contents:

Example:

<changeNumHybridizations weight="1.0">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp1">
    <apsp idref="apsp2">
    <apsp idref="apsp7">
    <apsp idref="apsp10">
    <geneTrees>
      <starTreeModel idref="starTreeModel4">
      <starTreeModel idref="starTreeModel5">
      <gtree popfactor="1.0">
        <partitionedTreeModel idref="partitionedTreeModel8">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies4">
    <tipPopulations value="1.0">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </tipPopulations>
    <rootPopulations value="1.0">
      <diagonalMatrix idref="diagonalMatrix7">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</changeNumHybridizations>

<circle> element

This element represents a regular circle polygon.

The element takes following attributes:

  • latitude is of type Double
  • longitude is of type Double
  • radius is of type Double
  • numberOfPoints (optional) is of type Integer

Example:

<circle latitude="1.0" longitude="1.0" radius="1.0" numberOfPoints="1"/>

<clusterSingleMoveOperator> element

An operator that moves single elements between clusters.

The element takes following attributes:

The element has the following contents:

Example:

<clusterSingleMoveOperator weight="1.0">
  <productParameter>
    <maskedParameter idref="maskedParameter6">
    <matrixMatrixProduct idref="matrixMatrixProduct8">
  </productParameter>
</clusterSingleMoveOperator>

<clusterSplitMergeOperator> element

An operator that splits and merges clusters.

The element takes following attributes:

The element has the following contents:

Example:

<clusterSplitMergeOperator weight="1.0">
  <leafTraitParameter taxon="foo" setBounds="true">
    <treeModel idref="treeModel8">
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter8">
  </leafTraitParameter>
  <locations>
    <dataFromTreeTips idref="dataFromTreeTips1">
  </locations>
</clusterSplitMergeOperator>

<cNcSPerSiteAnalysis> element

Performs a trace analysis of N and S counts.

The element takes following attributes:

  • cutoff (optional) is of type Double
  • burnin (optional) is of type Integer
  • includePValues (optional) is of type Boolean
  • includeSymbol (optional) is of type Boolean
  • includeClassification (optional) is of type Boolean
  • simulationOutcome (optional) is of type Boolean
  • siteSimulation (optional) is of type String
  • separator (optional) is of type String

Example:

<cNcSPerSiteAnalysis cutoff="1.0" burnin="1" includePValues="true" includeSymbol="true" includeClassification="true" simulationOutcome="true" siteSimulation="foo" separator="foo"/>

<cNcSTodNdSPerSiteAnalysis> element

Performs a trace analysis of N and S counts.

The element takes following attributes:

  • fileNameCN (optional) is of type String
  • fileNameCS (optional) is of type String
  • cutoff (optional) is of type Double
  • proportion (optional) is of type Double
  • burnin (optional) is of type Integer
  • sample (optional) is of type Boolean
  • includeHPD (optional) is of type Boolean
  • includeSymbol (optional) is of type Boolean
  • includeLevel (optional) is of type Boolean
  • includeClassification (optional) is of type Boolean
  • simulationOutcome (optional) is of type Boolean
  • siteSimulation (optional) is of type String
  • test (optional) is of type String
  • separator (optional) is of type String

Example:

<cNcSTodNdSPerSiteAnalysis fileNameCN="foo" fileNameCS="foo" cutoff="1.0" proportion="1.0" burnin="1" sample="true" includeHPD="true" includeSymbol="true" includeLevel="true" includeClassification="true" simulationOutcome="true" siteSimulation="foo" test="foo" separator="foo"/>

<coalescentConstantLikelihood> element

Calculates the number of possible combinations of coalescent events.

The element has the following contents:

Example:

<coalescentConstantLikelihood>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <starTreeModel idref="starTreeModel2">
    <rootHeight>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix7">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <immutableParameter idref="immutableParameter1">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <maskedParameter idref="maskedParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <fastMatrixParameter idref="fastMatrixParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundParameter idref="compoundParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <dataFromTreeTips idref="dataFromTreeTips10">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak10">
    </outbreak>
  </partitionedTreeModel>
</coalescentConstantLikelihood>

<coalescentEventsStatistic> element

The element has the following contents:

Example:

<coalescentEventsStatistic>
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <differenceParameter idref="differenceParameter9">
    </populationSizes>
    <precisionParameter>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    </precisionParameter>
    <populationTree>
      <partitionedTreeModel idref="partitionedTreeModel2">
      <partitionedTreeModel idref="partitionedTreeModel2">
    </populationTree>
  </gmrfSkyrideLikelihood>
</coalescentEventsStatistic>

<coalescentHeightsReferencePrior> element

Calculates the coalescent height probabilities based on a sample of coalescent heights.

The element takes following attributes:

The element has the following contents:

Example:

<coalescentHeightsReferencePrior fileName="foo" parameterColumn="foo" dimension="1">
  <externalLengthStatistic name="foo">
    <treeModel idref="treeModel2">
    <taxa idref="taxa3">
  </externalLengthStatistic>
</coalescentHeightsReferencePrior>

<coalescentIntervalStatistic> element

The element has the following contents:

Example:

<coalescentIntervalStatistic>
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <compoundParameter idref="compoundParameter3">
    </populationSizes>
    <precisionParameter>
      <matrixMatrixProduct idref="matrixMatrixProduct7">
    </precisionParameter>
    <populationTree>
      <starTreeModel idref="starTreeModel3">
      <treeModel idref="treeModel8">
    </populationTree>
  </gmrfSkyrideLikelihood>
</coalescentIntervalStatistic>

<coalescentLikelihood> element

This element represents the likelihood of the tree given the demographic function.

The element has the following contents:

  • Element named <model>
    The demographic model which describes the effective population size over time

    Containing:

  • Element named <populationTree>
    Tree(s) to compute likelihood for

    Containing:

    • factor (optional) is of type Double
  • Element named <include>
    An optional subset of taxa on which to calculate the likelihood (should be monophyletic)

    Containing:

    • Taxa element (exactly one)
  • Element named <exclude>
    One or more subsets of taxa which should be excluded from calculate the likelihood (should be monophyletic)

    Containing:

    • Taxa elements (one or more)

Example:

<coalescentLikelihood>
  <model>
    <logisticGrowth idref="logisticGrowth3">
  </model>
  <populationTree factor="1.0">
    <starTreeModel idref="starTreeModel10">
  </populationTree>
</coalescentLikelihood>

<coalescentSimulator> element

This element returns a simulated tree under the given demographic model. The element can be nested to simulate with monophyletic clades. The tree will be rescaled to the given height.

The element takes following attributes:

  • height (optional) is of type Double
    ””

The element has the following contents:

Example:

<coalescentSimulator height="1.0">
  <tree units="years">
    <node idref="node10">
  </tree>
  <mulSpeciesTree constantRoot="true" constantPopulation="true">
    <mulSpecies idref="mulSpecies5">
    <sppSplitPopulations value="1.0">
      <dataFromTreeTips idref="dataFromTreeTips5">
    </sppSplitPopulations>
  </mulSpeciesTree>
  <upgmaTree usingDates="true" rootHeight="1.0" nonzeroBranchLengths="true">
    <distanceMatrix idref="distanceMatrix3">
  </upgmaTree>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <treeModel idref="treeModel5">
    <rootHeight>
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundMatrixParameter idref="compoundMatrixParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <fastMatrixParameter idref="fastMatrixParameter10">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <fastMatrixParameter idref="fastMatrixParameter10">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <leafTraitParameter idref="leafTraitParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <duplicatedParameter idref="duplicatedParameter6">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak5">
    </outbreak>
  </partitionedTreeModel>
  <categoryOutbreak hasLatentPeriods="foo" hasGeography="true">
    <productStatistic idref="productStatistic8">
    <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo"/>
    <categoryCase wasEverInfected="true" hostID="foo" endTime="foo" latentCategory="foo" infectiousCategory="foo" indexPriorWeight="foo">
      <sp idref="sp6">
      <taxon idref="taxon1">
      <individual idref="individual8">
    </categoryCase>
    <taxa idref="taxa1">
    <infectiousPeriodPrior>
      <normalPeriodPriorDistribution idref="normalPeriodPriorDistribution7">
    </infectiousPeriodPrior>
    <infectiousPeriodPrior>
      <individualPrior idref="individualPrior6">
    </infectiousPeriodPrior>
    <infectiousPeriodPrior>
      <oneOverStDevPeriodPriorDistribution idref="oneOverStDevPeriodPriorDistribution3">
    </infectiousPeriodPrior>
    <latentPeriods>
      <dataFromTreeTips idref="dataFromTreeTips9">
    </latentPeriods>
    <latentPeriods>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter7">
    </latentPeriods>
    <latentPeriods>
      <parameter idref="parameter7">
    </latentPeriods>
    <latentPeriods>
      <productParameter idref="productParameter10">
    </latentPeriods>
  </categoryOutbreak>
  <attributePatterns attribute="foo" secondary="foo">
    <hiddenNucleotides idref="hiddenNucleotides9">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork2">
  </attributePatterns>
  <exponentialExponential units="substitutions">
    <populationSize>
      <productParameter idref="productParameter3">
    </populationSize>
    <growthRate>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </growthRate>
    <ancestralGrowthRate>
      <differenceParameter idref="differenceParameter1">
    </ancestralGrowthRate>
    <transitionTime>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    </transitionTime>
  </exponentialExponential>
</coalescentSimulator>

<coalescentTree> element

This element returns a simulated tree under the given demographic model.

The element takes following attributes:

  • rescaleHeight (optional) is of type Double
    “Attempt to rescale the tree to the given root height”
  • rootHeight (optional) is of type Double
    ””

The element has the following contents:

  • Tree elements (zero or more)

  • TaxonList elements (zero or more)

  • Element named <constrainedTaxa>

    Containing:

    • TaxonList elements (zero or more)

    • Element named <tmrca>

      Containing:

  • DemographicModel element (exactly one)

Example:

<coalescentTree rescaleHeight="1.0" rootHeight="1.0">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <argTreeModel idref="argTreeModel10">
    <rootHeight>
      <sumParameter idref="sumParameter3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice4">
    </nodeHeights>
    <leafHeight taxon="foo">
      <jointParameter idref="jointParameter10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <productParameter idref="productParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <jointParameter idref="jointParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <parameter idref="parameter10">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <diagonalMatrix idref="diagonalMatrix1">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundParameter idref="compoundParameter2">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak9">
    </outbreak>
  </partitionedTreeModel>
  <neighborJoiningTree>
    <distanceMatrix idref="distanceMatrix4">
  </neighborJoiningTree>
  <speciesTree bmPrior="true" constantRoot="true" constantPopulation="true">
    <species idref="species10">
    <sppSplitPopulations value="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter3">
    </sppSplitPopulations>
  </speciesTree>
  <upgmaTree usingDates="true" rootHeight="1.0" nonzeroBranchLengths="true">
    <distanceMatrix idref="distanceMatrix3">
  </upgmaTree>
  <taxa>
    <apsp idref="apsp6">
    <individual idref="individual3">
    <individual idref="individual9">
    <taxon idref="taxon10">
  </taxa>
  <tree units="generations">
    <node idref="node5">
  </tree>
  <cataclysm units="months">
    <populationSize>
      <parameter idref="parameter8">
    </populationSize>
    <growthRate>
      <jointParameter idref="jointParameter2">
    </growthRate>
    <declineRate>
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </declineRate>
    <timeOfCataclysm>
      <leafTraitParameter idref="leafTraitParameter5">
    </timeOfCataclysm>
  </cataclysm>
</coalescentTree>

<codonPartitionedRobustCounting> element

A parser to specify robust counting procedures on codon partitioned models

The element takes following attributes:

  • geneticCode (optional) is of type String
    “The genetic code to use”
  • useUniformization (optional) is of type Boolean
  • includeExternalBranches (optional) is of type Boolean
  • includeInternalBranches (optional) is of type Boolean
  • unconditionedPerBranch (optional) is of type Boolean
  • averageRates (optional) is of type Boolean
  • labeling is of type String
  • saveCompleteHistory (optional) is of type Boolean
  • useNewNeutralModel (optional) is of type Boolean

The element has the following contents:

Example:

<codonPartitionedRobustCounting geneticCode="echinodermMitochondrial" useUniformization="true" includeExternalBranches="true" includeInternalBranches="true" unconditionedPerBranch="true" averageRates="true" labeling="foo" saveCompleteHistory="true" useNewNeutralModel="true">
  <firstPosition>
    ERROR!
  </firstPosition>
  <secondPosition>
    ERROR!
  </secondPosition>
  <thirdPosition>
    ERROR!
  </thirdPosition>
  <starTreeModel>
    <argTreeModel idref="argTreeModel7">
    <rootHeight>
      <compoundParameter idref="compoundParameter8">
    </rootHeight>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter9">
    </leafHeight>
    <leafHeight taxon="foo">
      <vectorSlice idref="vectorSlice10">
    </leafHeight>
    <leafHeight taxon="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix1">
    </leafHeight>
  </starTreeModel>
</codonPartitionedRobustCounting>

<column> element

Specifies formating options for one or more columns in a log file.

The element takes following attributes:

  • label (optional) is of type String
    “The label of the column. If this is specified and more than one statistic is in this column, then the label will be appended by the index of the statistic to create individual column names”
  • sf (optional) is of type Integer
  • dp (optional) is of type Integer
  • width (optional) is of type Integer
  • format (optional) is of type String

The element has the following contents:

  • Object elements (one or more)

Example:

<column label="foo" sf="1" dp="1" width="1" format="foo">
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <inhibitionLikelihood idref="inhibitionLikelihood7">
  </continuousDiffusionStatistic>
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood7">
    <inhibitionLikelihood idref="inhibitionLikelihood9">
    <inhibitionLikelihood idref="inhibitionLikelihood4">
  </continuousDiffusionStatistic>
</column>

<compatibilityStatistic> element

A statistic that returns true if a pair of trees are compatible

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic for the purpose of logging”

The element has the following contents:

  • Tree element (exactly one)

  • Element named <compatibleWith>

    Containing:

    • Tree element (exactly one)
  • Tree element (exactly one)

Example:

<compatibilityStatistic name="foo">
  <speciesTree bmPrior="true" constantRoot="true" constantPopulation="true">
    <species idref="species3">
    <sppSplitPopulations value="1.0">
      <parameter idref="parameter6">
    </sppSplitPopulations>
  </speciesTree>
  <compatibleWith>
    <rescaledTree idref="rescaledTree4">
  </compatibleWith>
  <newick usingDates="true" usingHeights="true" rescaleHeight="1.0" rescaleLength="1.0" units="mutations">
    foo
  </newick>
</compatibilityStatistic>

<complementParameter> element

A element-wise complement of parameters.

The element has the following contents:

Example:

<complementParameter>
  <compoundMatrixParameter>
    <designMatrix idref="designMatrix3">
    <matrixParameter idref="matrixParameter4">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
  </compoundMatrixParameter>
</complementParameter>

<completeHistoryLogger> element

A logger to record all transitions in the complete history.

The element has the following contents:

Example:

<completeHistoryLogger>
  ERROR!
</completeHistoryLogger>

<complexSubstitutionModel> element

A general irreversible model of sequence substitution for any data type.

The element takes following attributes:

  • randomizeIndicator (optional) is of type Boolean
  • bssvsTolerance (optional) is of type Double
  • bssvsScalar (optional) is of type Double
  • checkConditioning (optional) is of type Boolean
  • normalized (optional) is of type Boolean

The element has the following contents:

  • One of:
    • dataType is of type String
      “The type of sequence data”
    • DataType element (exactly one)
  • One of:
    • Element named <frequencies>

      Containing:

    • Element named <rootFrequencies>

      Containing:

  • Element named <rates>

    Containing:

  • Element named <rateIndicator>

    Containing:

Example:

<complexSubstitutionModel dataType="generalDataType" randomizeIndicator="true" bssvsTolerance="1.0" bssvsScalar="1.0" checkConditioning="true" normalized="true">
  <rootFrequencies>
    <frequencyModel idref="frequencyModel6">
  </rootFrequencies>
  <rates/>
</complexSubstitutionModel>

<composedTransform> element

null

The element has the following contents:

Example:

<composedTransform>
  <outer>
    <inverseTransform idref="inverseTransform3">
  </outer>
  <inner>
    <inverseTransform idref="inverseTransform7">
  </inner>
</composedTransform>

<compositeDataType> element

Defines a composite DataType consisting of multiple data types

The element has the following contents:

Example:

<compositeDataType>
  <generalDataType>
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood9">
    <argCoalescentLikelihood idref="argCoalescentLikelihood5">
    <duplicatedParameter idref="duplicatedParameter7">
  </generalDataType>
  <microsatellite/>
</compositeDataType>

<compoundBranchRateModel> element

This element provides a strict clock model. All branches have the same rate of molecular evolution.

The element has the following contents:

Example:

<compoundBranchRateModel>
  <randomLocalClockModel ratesAreMultipliers="true" threshold="1.0">
    <treeModel idref="treeModel2">
    <rateIndicator>
      <parameter idref="parameter10">
    </rateIndicator>
    <rates>
      <diagonalMatrix idref="diagonalMatrix7">
    </rates>
  </randomLocalClockModel>
  <randomLocalClockModel ratesAreMultipliers="true" threshold="1.0">
    <starTreeModel idref="starTreeModel3">
    <rateIndicator>
      <productParameter idref="productParameter9">
    </rateIndicator>
    <rates>
      <fastMatrixParameter idref="fastMatrixParameter3">
    </rates>
  </randomLocalClockModel>
  <randomLocalClockModel ratesAreMultipliers="true" threshold="1.0">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel5">
    <rateIndicator>
      <maskedMatrixParameter idref="maskedMatrixParameter1">
    </rateIndicator>
    <rates>
      <differenceMatrixParameter idref="differenceMatrixParameter1">
    </rates>
  </randomLocalClockModel>
  <attributeBranchRateModel rateAttribute="foo">
    <treeModel idref="treeModel3">
  </attributeBranchRateModel>
</compoundBranchRateModel>

<compoundFastMatrixParameter> element

A compound matrix parameter constructed from its component parameters.

The element has the following contents:

Example:

<compoundFastMatrixParameter>
  <approximateFactorAnalysisPrecision>
    <L>
      <designMatrix idref="designMatrix1">
    </L>
    <gamma>
      <matrixMatrixProduct idref="matrixMatrixProduct5">
    </gamma>
  </approximateFactorAnalysisPrecision>
  <elementWiseMatrixMultiplicationParameter/>
</compoundFastMatrixParameter>

<compoundGaussianProcess> element

Returned a Gaussian process formed from an ordered list of independent Gaussian processes

The element has the following contents:

Example:

<compoundGaussianProcess>
  <gaussianProcessFromTree>
    ERROR!
  </gaussianProcessFromTree>
</compoundGaussianProcess>

<appendedPotentialDerivative> element

null

The element has the following contents:

Example:

<appendedPotentialDerivative>
  <appendedPotentialDerivative>
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood6">
    <sumDerivative idref="sumDerivative4">
    <sumDerivative idref="sumDerivative4">
    <gradient idref="gradient7">
  </appendedPotentialDerivative>
  <sumDerivative>
    <sumDerivative idref="sumDerivative2">
    <gradient idref="gradient8">
    <gradient idref="gradient10">
  </sumDerivative>
  <maskedGradient>
    <appendedPotentialDerivative idref="appendedPotentialDerivative2">
    <mask>
      <differenceMatrixParameter idref="differenceMatrixParameter9">
    </mask>
  </maskedGradient>
  <sumDerivative>
    <appendedPotentialDerivative idref="appendedPotentialDerivative1">
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood3">
    <appendedPotentialDerivative idref="appendedPotentialDerivative10">
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood2">
  </sumDerivative>
</appendedPotentialDerivative>

<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

  • threads (optional) is of type Integer

The element has the following contents:

Example:

<compoundLikelihood threads="1">
  <dirichletPrior counts="0.5 1.0" sumsTo="1.0">
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView9">
    <continuousDiffusionStatistic idref="continuousDiffusionStatistic3">
    <logarithmStatistic idref="logarithmStatistic7">
  </dirichletPrior>
  <productOfExponentialsPosteriorMeansLoess fileName="foo" parameterColumn="foo" dimension="1">
    <starTreeModel idref="starTreeModel9">
  </productOfExponentialsPosteriorMeansLoess>
</compoundLikelihood>

<compoundMatrixParameter> element

A compound matrix parameter constructed from its component parameters.

The element has the following contents:

Example:

<compoundMatrixParameter>
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <matrixMatrixProduct idref="matrixMatrixProduct8">
    </diagonal>
    <offDiagonal>
      <matrixParameter idref="matrixParameter4">
    </offDiagonal>
  </compoundSymmetricMatrix>
  <matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter1">
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter3">
  </matrixParameter>
</compoundMatrixParameter>

<compoundParameter> element

A multidimensional parameter constructed from its component parameters.

The element has the following contents:

Example:

<compoundParameter>
  <buildCompoundSymmetricMatrix/>
</compoundParameter>

<compoundSymmetricMatrix> element

A diagonal matrix parameter constructed from its diagonals.

The element takes following attributes:

  • asCorrelation (optional) is of type Boolean

The element has the following contents:

  • Element named <diagonal>

    Containing:

  • Element named <offDiagonal>

    Containing:

Example:

<compoundSymmetricMatrix asCorrelation="true">
  <diagonal>
    <sumParameter idref="sumParameter7">
  </diagonal>
  <offDiagonal>
    <copyParameterValues idref="copyParameterValues7">
  </offDiagonal>
</compoundSymmetricMatrix>

<compoundTransform> element

null

The element has the following contents:

Example:

<compoundTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform10">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform9">
    </inner>
  </composedTransform>
  <transform type="foo" start="1" end="1" every="1" inverseTransform="true">
    <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    <matrixMatrixProduct idref="matrixMatrixProduct8">
  </transform>
  <composedTransform>
    <outer>
      <composedTransform idref="composedTransform9">
    </outer>
    <inner>
      <transform idref="transform6">
    </inner>
  </composedTransform>
  <transform type="foo" start="1" end="1" every="1" inverseTransform="true">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    <dataFromTreeTips idref="dataFromTreeTips4">
    <maskedMatrixParameter idref="maskedMatrixParameter2">
    <maskedMatrixParameter idref="maskedMatrixParameter10">
  </transform>
  <jointParameter>
    <maskedParameter idref="maskedParameter6">
  </jointParameter>
</compoundTransform>

<conditionalCladeProbability> element

Calculates the conditional clade probability of a tree based on a sample of tree space.

The element takes following attributes:

The element has the following contents:

Example:

<conditionalCladeProbability fileName="foo" burnin="1" epsilon="1.0">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <speciesTree idref="speciesTree3">
    <rootHeight>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter6">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    </nodeHeights>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <complementParameter idref="complementParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <vectorSlice idref="vectorSlice9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <jointParameter idref="jointParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <productParameter idref="productParameter8">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter4">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak8">
    </outbreak>
  </partitionedTreeModel>
</conditionalCladeProbability>

<ConditionalCladeProbabilityAnalysis> element

Calculates posterior of a tree on a trace consisting of trees.

The element takes following attributes:

  • fileName is of type String
    “name of a tree log file”
  • burnIn (optional) is of type Integer
    “The number of trees discarded because of the burn-in period.”
  • minCladeProbability (optional) is of type Double
    “The frequency in % that a clade must achieve to be considered for the evaulation. Otherwise it’s set to epsilon.”
  • epsilon (optional) is of type Double
    “Epsilon is the default number of occurences for a clade if a clade wasn’t observed. The default is 1.0”
  • referenceTree is of type String
    “File in newick format containing a tree which is evaluated with the statistic.”

Example:

<ConditionalCladeProbabilityAnalysis fileName="trees.log" burnIn="1" minCladeProbability="1.0" epsilon="1.0" referenceTree="foo"/>

<constantDecreasedVariancePrior> element

Calculates a product of exponentials based on a set of posterior sample means.

The element takes following attributes:

The element has the following contents:

Example:

<constantDecreasedVariancePrior fileName="foo" parameterColumn="foo" dimension="1">
  <treeModel fixHeights="true" fixTree="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
    <rootHeight>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <complementParameter idref="complementParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <leafTraitParameter idref="leafTraitParameter7">
    </nodeHeights>
    <leafHeight taxon="foo">
      <differenceParameter idref="differenceParameter10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter5">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundParameter idref="compoundParameter5">
    </nodeRates>
  </treeModel>
</constantDecreasedVariancePrior>

<constantExponential> element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <growthPhaseStartTime>

    Containing:

  • One of:

    • Element named <growthRate>
      A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.

      Containing:

    • Element named <doublingTime>
      This parameter determines the doubling time.

      Containing:

Example:

<constantExponential units="generations">
  <populationSize>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision7">
  </populationSize>
  <growthPhaseStartTime>
    <differenceMatrixParameter idref="differenceMatrixParameter3">
  </growthPhaseStartTime>
  <doublingTime>
    <dataFromTreeTips idref="dataFromTreeTips10">
  </doublingTime>
</constantExponential>

<constantLikelihood> element

A function that returns a constant value as a likelihood.

The element takes following attributes:

Example:

<constantLikelihood logValue="1.0"/>

<constantLogistic> element

A demographic model of constant population size followed by logistic growth.

The element takes following attributes:

  • units is of type String
    “the units”
  • alpha is of type Double

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <ancestralPopulationSize>

    Containing:

  • Element named <growthRate>

    Containing:

  • Element named <shape>

    Containing:

Example:

<constantLogistic units="generations" alpha="1.0">
  <populationSize>
    <complementParameter idref="complementParameter5">
  </populationSize>
  <ancestralPopulationSize>
    <diagonalMatrix idref="diagonalMatrix3">
  </ancestralPopulationSize>
  <growthRate>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter5">
  </growthRate>
  <shape>
    <designMatrix idref="designMatrix8">
  </shape>
</constantLogistic>

<constantPatterns> element

Creates a set of patterns for constant sites with weights as provided.

The element has the following contents:

  • PatternList element (exactly one)

  • Element named <counts>

    Containing:

Example:

<constantPatterns>
  <microsatelliteSimulator>
    <microsatellite idref="microsatellite2">
    <taxa idref="taxa4">
    <treeModel idref="treeModel7">
    ERROR!
  </microsatelliteSimulator>
  <counts>
    <compoundParameter idref="compoundParameter10">
  </counts>
</constantPatterns>

<constantSize> element

A demographic model representing a constant population size through time.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

Example:

<constantSize units="months">
  <populationSize>
    <matrixMatrixProduct idref="matrixMatrixProduct3">
  </populationSize>
</constantSize>

<constantTreeTopologyPrior> element

Calculates the constant tree topology prior, i.e. 1 over the total number of rooted bifurcating trees.

The element has the following contents:

Example:

<constantTreeTopologyPrior>
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork7">
    <rootHeight>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <parameter idref="parameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
    </nodeHeights>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundParameter idref="compoundParameter5">
    </nodeTraits>
    <leafTrait taxon="foo" name="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter10">
    </leafTrait>
  </treeModel>
</constantTreeTopologyPrior>

<constExpConst> element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”
  • useNumericalIntegration (optional) is of type Boolean

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • One of:
    • Element named <ancestralPopulationSize>

      Containing:

    • Element named <growthRate>

      Containing:

  • Element named <finalPhaseStartTime>

    Containing:

  • Element named <growthPhaseTime>

    Containing:

Example:

<constExpConst units="days" useNumericalIntegration="true">
  <populationSize>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix4">
  </populationSize>
  <ancestralPopulationSize>
    <jointParameter idref="jointParameter6">
  </ancestralPopulationSize>
  <finalPhaseStartTime>
    <immutableParameter idref="immutableParameter4">
  </finalPhaseStartTime>
  <growthPhaseTime>
    <mvPolyaLikelihood idref="mvPolyaLikelihood9">
  </growthPhaseTime>
</constExpConst>

<contemporaneousCoalescentConstantLikelihood> element

Calculates the number of possible combinations of coalescent events.

The element has the following contents:

Example:

<contemporaneousCoalescentConstantLikelihood>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <sequenceSimulator idref="sequenceSimulator10">
  </empiricalTreeDistributionModel>
</contemporaneousCoalescentConstantLikelihood>

<continuousBranchRates> element

This element returns a continuous quantile uncorrelated relaxed clock model.

The element takes following attributes:

  • singleRootRate (optional) is of type Boolean
    “Whether only a single rate should be used for the two children branches of the root”
  • normalize (optional) is of type Boolean
    “Whether the mean rate has to be normalized to a particular value”
  • normalizeBranchRateTo (optional) is of type Double
    “The mean rate to normalize to, if normalizing”

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <distribution>
    The distribution model for rates among branches

    Containing:

  • One of:
    • Element named <rateQuantiles>
      The quantiles for each branch

      Containing:

    • Element named <rateCategoryQuantiles>
      The quantiles for each branch

      Containing:

Example:

<continuousBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0">
  <treeModel fixHeights="true" fixTree="true">
    <newick idref="newick5">
    <rootHeight>
      <compoundParameter idref="compoundParameter9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <differenceMatrixParameter idref="differenceMatrixParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter7">
    </nodeHeights>
    <leafHeight taxon="foo">
      <designMatrix idref="designMatrix2">
    </leafHeight>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixParameter idref="matrixParameter6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser10">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixMatrixProduct idref="matrixMatrixProduct5">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <sumParameter idref="sumParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter9">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter8">
    </leafTrait>
  </treeModel>
  <distribution>
    <uniformDistributionModel idref="uniformDistributionModel1">
  </distribution>
  <rateQuantiles>
    <dataFromTreeTips idref="dataFromTreeTips2">
  </rateQuantiles>
</continuousBranchRates>

<continuousDiffusionStatistic> element

A statistic that returns the average of the branch diffusion rates

The element takes following attributes:

  • name (optional) is of type String
  • greatCircleDistance (optional) is of type Boolean
  • mode (optional) is of type String
  • statistic (optional) is of type String
  • discreteState (optional) is of type String
  • heightUpper (optional) is of type Double
  • heightLower (optional) is of type Double
  • heightLowerSerie (optional) is of type String
  • dimension (optional) is of type Double
  • cumulative (optional) is of type Boolean
  • noise (optional) is of type Boolean
  • branchSet (optional) is of type String

The element has the following contents:

Example:

<continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <dataFromTreeTips idref="dataFromTreeTips3">
    </traitParameter>
    <bifractionalDiffusionModel idref="bifractionalDiffusionModel7">
    <starTreeModel idref="starTreeModel4">
  </multivariateTraitLikelihood>
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <compoundMatrixParameter idref="compoundMatrixParameter3">
    </traitParameter>
    <mixtureCartogramDiffusionModel idref="mixtureCartogramDiffusionModel8">
    <starTreeModel idref="starTreeModel1">
    ERROR!
  </multivariateTraitLikelihood>
  <inhibitionLikelihood>
    <treeModel idref="treeModel2">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix10">
    <precision>
      <differenceMatrixParameter idref="differenceMatrixParameter5">
    </precision>
  </inhibitionLikelihood>
</continuousDiffusionStatistic>

<continuousTraitRateModel> element

This element returns an trait rate model.The branch rates are an average of the rates provided by a node trait.

The element takes following attributes:

  • dimension (optional) is of type Integer
    “The dimension that supplies the rate”

The element has the following contents:

Example:

<continuousTraitRateModel dimension="1"/>

<convert> element

Converts an alignment to the given data type.

The element takes following attributes:

  • dataType is of type String
    “The type of sequence data”

The element has the following contents:

Example:

<convert dataType="hiddenCodon3">
  <alignment dataType="codon-ascidianMitochondrial">
    <sequence idref="sequence2">
    <sequence idref="sequence5">
    <sequence idref="sequence2">
  </alignment>
</convert>

<coordinates> element

This element represents a set of (X,Y,Z) coordinates in KML format

The element has the following contents:

  • String element (exactly one)

Example:

<coordinates>
  foo
</coordinates>

<copyParameterValues> element

Copy parameter values from source to destination

The element has the following contents:

  • Element named <source>

    Containing:

  • Element named <destination>

    Containing:

Example:

<copyParameterValues>
  <source>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix4">
  </source>
  <destination>
    <complementParameter idref="complementParameter2">
  </destination>
</copyParameterValues>

<correlation> element

This element returns a precision that is the element-wise reciprocal of the child precision.

The element takes following attributes:

The element has the following contents:

Example:

<correlation dimension1="1" dimension2="1">
  <designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision1">
  </designMatrix>
</correlation>

<countableMixtureBranchRates> element

This element provides a clock consisting of a mixture of fixed effects and random effects.

The element takes following attributes:

  • inLogSpace (optional) is of type Boolean
  • randomize (optional) is of type Boolean

The element has the following contents:

  • TreeModel element (exactly one)

  • One of:
    • Element named <rates>
      The molecular evolutionary rate parameter

      Containing:

    • Element named <fixedEffects>
      Fixed effects

      Containing:

  • Element named <rateCategories>
    Allocation parameter

    Containing:

  • Element named <randomEffects>
    Possible random effects

    Containing:

  • Element named <clade>

    Containing:

    • category is of type Integer
    • includeStem (optional) is of type Boolean
      “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
    • excludeClade (optional) is of type Boolean
      “determines whether to exclude actual branches of the clade from the siteModel (default false).”
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to

Example:

<countableMixtureBranchRates inLogSpace="true" randomize="true">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <argTreeModel idref="argTreeModel8">
    <rootHeight>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <parameter idref="parameter8">
    </nodeHeights>
    <leafHeight taxon="foo">
      <parameter idref="parameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixMatrixProduct idref="matrixMatrixProduct2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter10">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceParameter idref="differenceParameter5">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundMatrixParameter idref="compoundMatrixParameter7">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak1">
    </outbreak>
  </partitionedTreeModel>
  <rates>
    <copyParameterValues idref="copyParameterValues6">
  </rates>
  <rateCategories>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser6">
  </rateCategories>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa2">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa3">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa2">
  </clade>
  <clade category="1" includeStem="true" excludeClade="true">
    <taxa idref="taxa9">
  </clade>
</countableMixtureBranchRates>

<CSVexport> element

Write tabular data as an CSV file.

The element takes following attributes:

  • fileName is of type String
    “The name of a BEAST log file (can not include trees, which should be logged separately”
  • separator (optional) is of type String
    “Values separator (default is tab)”

The element has the following contents:

  • Element named <columns>
    A subset of columns from one source

    Containing:

    • all (optional) is of type Boolean
    “Dump all columns. default is TRUE when no columns are specified, FALSE otherwise”
    • rows (optional) is of type Boolean
    “Write data in rows (default is columns)”
    • TabularData element (exactly one)

    • Element named <CSVcolumn>

    column name
    Containing:
    
    * <code>name</code>  is of type [String;](#string;)
    

Example:

<CSVexport fileName="foo" separator="foo">
  <columns all="true" rows="true">
    <logFileTrace idref="logFileTrace4">
  </columns>
</CSVexport>

<ctmcScalePrior> element

This element represents the prior for CTMC scale parameter.

The element takes following attributes:

  • reciprocal (optional) is of type Boolean
  • trial (optional) is of type Boolean

The element has the following contents:

Example:

<ctmcScalePrior reciprocal="true" trial="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <microsatelliteSimulator idref="microsatelliteSimulator3">
  </empiricalTreeDistributionModel>
  <ctmcScale>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
  </ctmcScale>
</ctmcScalePrior>

<dataFromTreeTips> element

Takes the data from the tips of a tree and puts it into a MatrixParameter

The element takes following attributes:

The element has the following contents:

  • MultivariateTraitTree element (exactly one)

  • Element named <traitParameter>

    Containing:

  • Element named <missingIndicator>

    Containing:

Example:

<dataFromTreeTips traitName="foo">
  <transformedTreeModel version="foo">
    <partitionedTreeModel idref="partitionedTreeModel2">
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser6">
  </transformedTreeModel>
  <traitParameter>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
  </traitParameter>
</dataFromTreeTips>

<dataLikelihood> element

null

The element has the following contents:

Example:

<dataLikelihood>
  ERROR!
</dataLikelihood>

<date> element

Specifies a date on a given timescale

The element takes following attributes:

  • value is of type String
    “The value of this date”
  • origin (optional) is of type String
    “The origin of this time scale, which must be a valid calendar date”
  • units (optional) is of type String
    “The units of the timescale”
  • direction (optional) is of type String
    “The direction of the timescale”
  • precision (optional) is of type Double
    “The precision to which the date is specified”

Example:

<!-- a date representing 10 years in the past                                 -->
<date value="10.0" units="years" direction="backwards"/>

<!-- a date representing 300 days after Jan 1st 1989                          -->
<date value="300.0" origin="01/01/89" units="days" direction="forwards"/>

<deltaExchange> element

This element returns a delta exchange operator on a given parameter.

The element takes following attributes:

  • delta is of type Double
  • parameterWeights (optional) is of type Integer;
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • integer (optional) is of type Boolean

The element has the following contents:

Example:

<deltaExchange delta="1.0" parameterWeights="1 2 4 8" weight="1.0" autoOptimize="true" integer="true">
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <leafTraitParameter idref="leafTraitParameter8">
    </diagonal>
    <offDiagonal>
      <immutableParameter idref="immutableParameter5">
    </offDiagonal>
  </compoundSymmetricMatrix>
</deltaExchange>

<deltaMixOperator> element

This element returns a scale operator on a given parameter.

The element takes following attributes:

  • delta is of type Double
  • parameterWeights (optional) is of type Integer;
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean

The element has the following contents:

Example:

<deltaMixOperator delta="1.0" parameterWeights="1 2 4 8" weight="1.0" autoOptimize="true">
  <differenceMatrixParameter/>
</deltaMixOperator>

<designMatrix> element

A matrix parameter constructed from its component parameters.

The element takes following attributes:

  • addIntercept (optional) is of type Boolean
  • checkIdentifiability (optional) is of type Boolean
  • form (optional) is of type String
  • colDimension (optional) is of type Integer
  • rowDimension (optional) is of type Integer
  • standardize (optional) is of type Boolean

The element has the following contents:

Example:

<designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <designMatrix idref="designMatrix9">
    <extendedDataType idref="extendedDataType3">
  </originDestinationDesignMatrix>
</designMatrix>

<diagonalContrainedMatrixView> element

A diagonal matrix parameter constructed from its diagonals.

The element takes following attributes:

  • constraintValue (optional) is of type Double

The element has the following contents:

Example:

<diagonalContrainedMatrixView constraintValue="1.0">
  <dataFromTreeTips traitName="foo">
    <starTreeModel idref="starTreeModel4">
    <traitParameter>
      <dataFromTreeTips idref="dataFromTreeTips7">
    </traitParameter>
  </dataFromTreeTips>
  <mask>
    <maskedMatrixParameter idref="maskedMatrixParameter7">
  </mask>
</diagonalContrainedMatrixView>

<diagonalMatrix> element

A diagonal matrix parameter constructed from its diagonals.

The element has the following contents:

Example:

<diagonalMatrix>
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter10">
    </diagonal>
    <offDiagonal>
      <maskedParameter idref="maskedParameter8">
    </offDiagonal>
  </compoundSymmetricMatrix>
</diagonalMatrix>

<differenceStatistic> element

This element returns a statistic that is the difference of the 2 child statistics.

The element takes following attributes:

  • absolute (optional) is of type Boolean

The element has the following contents:

  • Statistic elements (exactly 2)
    The two operand statistics

Example:

<differenceStatistic absolute="true">
  <compoundSymmetricMatrix asCorrelation="true">
    <diagonal>
      <fastMatrixParameter idref="fastMatrixParameter8">
    </diagonal>
    <offDiagonal>
      <complementParameter idref="complementParameter4">
    </offDiagonal>
  </compoundSymmetricMatrix>
  <maskedParameter complement="true" build="true" from="1" to="1" every="1">
    <complementParameter idref="complementParameter8">
  </maskedParameter>
</differenceStatistic>

<differenceMatrixParameter> element

differenceMatrixParameter

Example:

<differenceMatrixParameter/>

<differenceParameter> element

A element-wise difference of parameters.

The element has the following contents:

Example:

<differenceParameter>
  <complementParameter>
    <vectorSlice idref="vectorSlice2">
  </complementParameter>
  <fastMatrixParameter rows="1" columns="1">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    <dataFromTreeTips idref="dataFromTreeTips2">
    <matrixVectorProductParameter idref="matrixVectorProductParameter6">
    <productParameter idref="productParameter8">
  </fastMatrixParameter>
  <immutableParameter>
    <exponentialStatistic idref="exponentialStatistic3">
  </immutableParameter>
  <blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true"/>
</differenceParameter>

<differenceStatistic> element

This element returns a statistic that is the difference of the 2 child statistics.

The element takes following attributes:

  • absolute (optional) is of type Boolean

The element has the following contents:

  • Statistic elements (exactly 2)
    The two operand statistics

Example:

<differenceStatistic absolute="true">
  <generalizedSkylinePopSizeStatistic/>
  <differenceParameter>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    <duplicatedParameter idref="duplicatedParameter5">
    <vectorSlice idref="vectorSlice6">
  </differenceParameter>
</differenceStatistic>

<diffusionRateCovarianceStatistic> element

A statistic that returns the average of the branch rates

The element takes following attributes:

  • name (optional) is of type String
  • greatCircleDistance (optional) is of type Boolean
  • diffusionCoefficient (optional) is of type Boolean

The element has the following contents:

Example:

<diffusionRateCovarianceStatistic name="foo" greatCircleDistance="true" diffusionCoefficient="true">
  <transformedTreeModel version="foo">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4">
    <designMatrix idref="designMatrix5">
  </transformedTreeModel>
  <inhibitionLikelihood>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
    <compoundMatrixParameter idref="compoundMatrixParameter2">
    <precision>
      <vectorSlice idref="vectorSlice5">
    </precision>
  </inhibitionLikelihood>
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </traitParameter>
    <bifractionalDiffusionModel idref="bifractionalDiffusionModel3">
    <transformedTreeModel idref="transformedTreeModel3">
    ERROR!
  </multivariateTraitLikelihood>
  <inhibitionLikelihood>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    <precision>
      <dataFromTreeTips idref="dataFromTreeTips5">
    </precision>
  </inhibitionLikelihood>
</diffusionRateCovarianceStatistic>

<continuousDiffusionStatistic> element

A statistic that returns the average of the branch diffusion rates

The element takes following attributes:

  • name (optional) is of type String
  • greatCircleDistance (optional) is of type Boolean
  • mode (optional) is of type String
  • statistic (optional) is of type String
  • discreteState (optional) is of type String
  • heightUpper (optional) is of type Double
  • heightLower (optional) is of type Double
  • heightLowerSerie (optional) is of type String
  • dimension (optional) is of type Double
  • cumulative (optional) is of type Boolean
  • noise (optional) is of type Boolean
  • branchSet (optional) is of type String

The element has the following contents:

Example:

<continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
  <inhibitionLikelihood>
    <partitionedTreeModel idref="partitionedTreeModel9">
    <designMatrix idref="designMatrix6">
    <precision>
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </precision>
  </inhibitionLikelihood>
  <inhibitionLikelihood>
    <partitionedTreeModel idref="partitionedTreeModel4">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix6">
    <precision>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter5">
    </precision>
  </inhibitionLikelihood>
</continuousDiffusionStatistic>

<dirichletParameterPrior> element

Calculates the likelihood of some data under a Dirichlet distribution.

The element takes following attributes:

  • sumToNumberOfElements (optional) is of type Boolean

The element has the following contents:

  • Element named <countsParameter>

    Containing:

  • Element named <data>

    Containing:

Example:

<dirichletParameterPrior sumToNumberOfElements="true">
  <countsParameter>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
  </countsParameter>
  <data>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter6">
  </data>
  <data>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix4">
  </data>
</dirichletParameterPrior>

<dirichletPrior> element

Calculates the prior probability of some data under a Dirichlet distribution.

The element takes following attributes:

  • sumsTo (optional) is of type Double

The element has the following contents:

Example:

<dirichletPrior counts="0.5 1.0" sumsTo="1.0">
  <parsimonyStatistic name="foo">
    <treeModel idref="treeModel9">
    <state>
      <taxa idref="taxa4">
    </state>
  </parsimonyStatistic>
  <transmissionStatistic name="foo">
    <hostTree>
      <tree idref="tree2">
    </hostTree>
    <parasiteTree>
      <newick idref="newick1">
    </parasiteTree>
  </transmissionStatistic>
  <notBooleanStatistic>
    <test idref="test2">
  </notBooleanStatistic>
  <logarithmStatistic base="1.0">
    <popGraph idref="popGraph3">
  </logarithmStatistic>
</dirichletPrior>

<dirichletProcessLikelihood> element

Calculates the likelihood of some items distributed into a number of classes under a Dirichlet drocess.

The element has the following contents:

  • Element named <eta>
    Counts of N items distributed amongst K classes

    Containing:

  • Element named <chi>
    Aggregation parameter

    Containing:

Example:

<dirichletProcessLikelihood>
  <eta>
    <driftedLocationsStatistic idref="driftedLocationsStatistic5">
  </eta>
  <chi>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter4">
  </chi>
</dirichletProcessLikelihood>

<dirichletProcessOperator> element

An operator that picks a new allocation of an item to a cluster under the Dirichlet process.

The element takes following attributes:

The element has the following contents:

  • Element named <chi>

    Containing:

  • Element named <likelihood>

    Containing:

  • Parameter element (exactly one)

Example:

<dirichletProcessOperator weight="1.0">
  <chi>
    <compoundMatrixParameter idref="compoundMatrixParameter3">
  </chi>
  <compoundFastMatrixParameter>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision2">
    <mvPolyaLikelihood idref="mvPolyaLikelihood7">
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
  </compoundFastMatrixParameter>
</dirichletProcessOperator>

<dirtyLikelihood> element

This element returns a operator that forces the entire model likelihood recomputation

The element takes following attributes:

The element has the following contents:

Example:

<dirtyLikelihood weight="1.0">
  <productOfGammas fileName="foo" parameterColumn="foo" dimension="1" popSize="1.0">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
  </productOfGammas>
</dirtyLikelihood>

<discreteTraitRateModel> element

This Branch Rate Model takes a discrete trait reconstruction (provided by a TreeTraitProvider) and gives the rate for each branch of the tree based on the child trait of that branch. The rates for each trait value are specified in a multidimensional parameter.

The element takes following attributes:

  • traitIndex (optional) is of type Integer
  • traitName (optional) is of type String

The element has the following contents:

  • TreeModel element (exactly one)
    The tree model
  • One of:
  • One of:
    • All of:
      • Element named <rate>
        The over-all rate

        Containing:

      • Element named <relativeRates>
        The state-specific relative rates

        Containing:

    • Element named <rates>
      The state-specific rates

      Containing:

Example:

<discreteTraitRateModel traitIndex="1" traitName="foo">
  <starTreeModel>
    <neighborJoiningTree idref="neighborJoiningTree7">
    <rootHeight>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </rootHeight>
    <leafHeight taxon="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <mvPolyaLikelihood idref="mvPolyaLikelihood9">
    </leafTrait>
  </starTreeModel>
  <maskedPatterns negative="true">
    <convert idref="convert9">
    <mask>
      foo
    </mask>
  </maskedPatterns>
  <rates>
    <jointParameter idref="jointParameter1">
  </rates>
</discreteTraitRateModel>

<discreteUniformPrior> element

Calculates the prior probability of some data under a given discrete uniform distribution.

The element takes following attributes:

The element has the following contents:

Example:

<discreteUniformPrior lower="1.0" upper="1.0">
  <argReassortmentNodeCount name="foo">
    <argTreeModel idref="argTreeModel4">
  </argReassortmentNodeCount>
  <logarithmStatistic base="1.0">
    <compoundParameter idref="compoundParameter5">
  </logarithmStatistic>
</discreteUniformPrior>

<discretizedBranchRates> element

This element returns an discretized relaxed clock model.The branch rates are drawn from a discretized parametric distribution.

The element takes following attributes:

  • singleRootRate (optional) is of type Boolean
    “Whether only a single rate should be used for the two children branches of the root”
  • overSampling (optional) is of type Integer
    “The integer factor for oversampling the distribution model (1 means no oversampling)”
  • normalize (optional) is of type Boolean
    “Whether the mean rate has to be normalized to a particular value”
  • normalizeBranchRateTo (optional) is of type Double
    “The mean rate to normalize to, if normalizing”
  • randomizeRates (optional) is of type Boolean
    “Randomize initial categories”
  • keepRates (optional) is of type Boolean
    “Keep current rate category specification”
  • cachedRates (optional) is of type Boolean
    “Cache rates between steps (default off)”

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <distribution>
    The distribution model for rates among branches

    Containing:

  • Element named <rateCategories>
    The rate categories parameter

    Containing:

Example:

<discretizedBranchRates singleRootRate="true" overSampling="1" normalize="true" normalizeBranchRateTo="1.0" randomizeRates="true" keepRates="true" cachedRates="true">
  <starTreeModel>
    <transformedTreeModel idref="transformedTreeModel10">
    <sharedRootHeight>
      <treeModel idref="treeModel1">
    </sharedRootHeight>
    <leafHeight taxon="foo">
      <copyParameterValues idref="copyParameterValues8">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedParameter idref="maskedParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <copyParameterValues idref="copyParameterValues7">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter5">
    </leafTrait>
  </starTreeModel>
  <distribution>
    <inverseGammaDistributionModel idref="inverseGammaDistributionModel7">
  </distribution>
  <rateCategories>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix8">
  </rateCategories>
</discretizedBranchRates>

<discretizedLocationOperator> element

This element returns a multivariate Gibbs operator on traits for possible all nodes.

The element takes following attributes:

  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • onlyInternalNodes (optional) is of type Boolean
  • neighborhoodSize (optional) is of type Integer
  • randomize (optional) is of type Boolean

The element has the following contents:

Example:

<discretizedLocationOperator weight="1.0" autoOptimize="true" onlyInternalNodes="true" neighborhoodSize="1" randomize="true">
  <inhibitionLikelihood>
    <starTreeModel idref="starTreeModel7">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix2">
    <precision>
      <fastMatrixParameter idref="fastMatrixParameter3">
    </precision>
  </inhibitionLikelihood>
</discretizedLocationOperator>

<distanceDependentCRPGibbsOperator> element

An operator that picks a new allocation of an item to a cluster under the Dirichlet process.

The element takes following attributes:

The element has the following contents:

  • Element named <chi>

    Containing:

  • Element named <likelihood>

    Containing:

  • Element named <assignments>

    Containing:

  • Element named <links>

    Containing:

Example:

<distanceDependentCRPGibbsOperator weight="1.0">
  <chi>
    <fastMatrixParameter idref="fastMatrixParameter8">
  </chi>
  <assignments>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
  </assignments>
  <links>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix1">
  </links>
</distanceDependentCRPGibbsOperator>

<distanceMatrix> element

Constructs a distance matrix from a pattern list or alignment

The element takes following attributes:

  • correction is of type String
    “The type of distance correction used”

The element has the following contents:

Example:

<distanceMatrix correction="JC">
  <patterns from="1" to="1" every="1" strip="true" unique="true">
    <convert idref="convert6">
  </patterns>
</distanceMatrix>

<distributionLikelihood> element

Calculates the likelihood of some data given some parametric or empirical distribution.

The element has the following contents:

Example:

<distributionLikelihood>
  <distribution>
    <exponentialDistributionModel idref="exponentialDistributionModel2">
  </distribution>
  <data from="1" to="1">
    <jointParameter idref="jointParameter6">
  </data>
</distributionLikelihood>

<dNdSLogger> element

null

The element takes following attributes:

  • smooth (optional) is of type Boolean
  • counts (optional) is of type Boolean
  • synonymous (optional) is of type Boolean
  • dn-ds (optional) is of type Boolean

The element has the following contents:

Example:

<dNdSLogger smooth="true" counts="true" synonymous="true" dn-ds="true">
  <codonPartitionedRobustCounting geneticCode="alternativeYeast" useUniformization="true" includeExternalBranches="true" includeInternalBranches="true" unconditionedPerBranch="true" averageRates="true" labeling="foo" saveCompleteHistory="true" useNewNeutralModel="true">
    <firstPosition>
      ERROR!
    </firstPosition>
    <secondPosition>
      ERROR!
    </secondPosition>
    <thirdPosition>
      ERROR!
    </thirdPosition>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
  </codonPartitionedRobustCounting>
  <codonPartitionedRobustCounting geneticCode="universal" useUniformization="true" includeExternalBranches="true" includeInternalBranches="true" unconditionedPerBranch="true" averageRates="true" labeling="foo" saveCompleteHistory="true" useNewNeutralModel="true">
    <firstPosition>
      ERROR!
    </firstPosition>
    <secondPosition>
      ERROR!
    </secondPosition>
    <thirdPosition>
      ERROR!
    </thirdPosition>
    <partitionedTreeModel idref="partitionedTreeModel7">
  </codonPartitionedRobustCounting>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <tree idref="tree2">
  </empiricalTreeDistributionModel>
</dNdSLogger>

<dNdSPerSiteAnalysis> element

Performs a trace dN/dS analysis.

The element takes following attributes:

  • cutoff (optional) is of type Double
  • proportion (optional) is of type Double
  • burnin (optional) is of type Integer
  • includeHPD (optional) is of type Boolean
  • includeCPD (optional) is of type Boolean
  • includeSymbol (optional) is of type Boolean
  • includeLevel (optional) is of type Boolean
  • includeClassification (optional) is of type Boolean
  • simulationOutcome (optional) is of type Boolean
  • siteSimulation (optional) is of type String
  • test (optional) is of type String
  • separator (optional) is of type String
  • fileName is of type String
    “The traceName of a BEAST log file (can not include trees, which should be logged separately”

Example:

<dNdSPerSiteAnalysis cutoff="1.0" proportion="1.0" burnin="1" includeHPD="true" includeCPD="true" includeSymbol="true" includeLevel="true" includeClassification="true" simulationOutcome="true" siteSimulation="foo" test="foo" separator="foo" fileName="foo"/>

<double> element

returns a Double. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as a Double.

The element has the following contents:

  • One of:
    • prompt is of type String
      “A message displayed to the user when entering a value for this double”
    • Double element (exactly one)

Example:

<double prompt="Enter the length of a piece of string (in metres):"/>

<driftedLocationsStatistic> element

This element returns a statistic that shifts a matrix of locations by location drift in the first dimension.

The element has the following contents:

  • Element named <locations>

    Containing:

  • Element named <offsets>

    Containing:

  • Element named <locationDrift>

    Containing:

Example:

<driftedLocationsStatistic>
  <locations>
    <matrixMatrixProduct idref="matrixMatrixProduct8">
  </locations>
  <offsets>
    <matrixVectorProductParameter idref="matrixVectorProductParameter7">
  </offsets>
  <locationDrift>
    <sumParameter idref="sumParameter5">
  </locationDrift>
</driftedLocationsStatistic>

<driftedTraits> element

null

The element has the following contents:

Example:

<driftedTraits>
  <multivariateTraitLikelihood traitName="foo" integrateInternalTraits="true" cut="0.5 1.0" reportAsMultivariate="true" useTreeLength="true" scaleByTime="true" reciprocalRates="true" cacheBranches="true" randomSample="1" ignorePhylogeny="true" exchangeableTips="true" sampleMissingTraits="true">
    <traitParameter>
      <differenceParameter idref="differenceParameter1">
    </traitParameter>
    <cartogramDiffusionModel idref="cartogramDiffusionModel3">
    <partitionedTreeModel idref="partitionedTreeModel6">
    ERROR!
    ERROR!
    ERROR!
  </multivariateTraitLikelihood>
  <elementWiseMatrixMultiplicationParameter/>
</driftedTraits>

<dummyLikelihood> element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.

The element has the following contents:

  • One of:
    • Model element (exactly one)
      A model element
    • Parameter element (exactly one)
      A parameter

Example:

<dummyLikelihood>
  <lewisMk totalOrder="true">
    <frequencies>
      <frequencyModel idref="frequencyModel3">
    </frequencies>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
  </lewisMk>
</dummyLikelihood>

<dummyModel> element

A function wraps a component model that would otherwise not be registered with the MCMC. Always returns a log likelihood of zero.

The element has the following contents:

Example:

<dummyModel>
  <diagonalMatrix>
    <dataFromTreeTips idref="dataFromTreeTips8">
  </diagonalMatrix>
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix1">
    <generalDataType idref="generalDataType3">
  </originDestinationDesignMatrix>
  <blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true">
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
  </blockUpperTriangularMatrixParameter>
  <leafTraitParameter taxon="foo" setBounds="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix7">
  </leafTraitParameter>
</dummyModel>

<duplicatedParameter> element

A duplicated parameter.

The element has the following contents:

  • Parameter element (exactly one)

  • Element named <copies>

    Containing:

Example:

<duplicatedParameter>
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <designMatrix idref="designMatrix4">
    <extendedDataType idref="extendedDataType1">
  </originDestinationDesignMatrix>
  <copies>
    <productParameter idref="productParameter2">
  </copies>
</duplicatedParameter>

<elementWiseMatrixMultiplicationParameter> element

Returns element wise matrix multiplication of a series of matrices

Example:

<elementWiseMatrixMultiplicationParameter/>

<ellipticalSliceSampler> element

An elliptical slice sampler for parameters with Gaussian priors.

The element takes following attributes:

  • weight is of type Double
  • signalConstituentParameters (optional) is of type Boolean
  • bracketAngle (optional) is of type Double
  • translationInvariant (optional) is of type Boolean
  • rotationInvariant (optional) is of type Boolean
  • drawByRow (optional) is of type Boolean

The element has the following contents:

Example:

<ellipticalSliceSampler weight="1.0" signalConstituentParameters="true" bracketAngle="1.0" translationInvariant="true" rotationInvariant="true" drawByRow="true">
  <productParameter>
    <jointParameter idref="jointParameter9">
  </productParameter>
  <normalDistributionModel>
    <mean>
      <matrixMatrixProduct idref="matrixMatrixProduct7">
    </mean>
    <precision>
      <productParameter idref="productParameter8">
    </precision>
  </normalDistributionModel>
</ellipticalSliceSampler>

<emergingEpidemic> element

A self-consistent model of emerging epidemics.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <growthRate>

    Containing:

  • Element named <generationTime>

    Containing:

  • Element named <generationShape>

    Containing:

  • Element named <offspringDispersion>

    Containing:

  • Element named <epidemicTree>

    Containing:

    • Tree element (exactly one)

Example:

<emergingEpidemic units="substitutions">
  <growthRate>
    <compoundMatrixParameter idref="compoundMatrixParameter10">
  </growthRate>
  <generationTime>
    <maskedMatrixParameter idref="maskedMatrixParameter6">
  </generationTime>
  <generationShape>
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix6">
  </generationShape>
  <offspringDispersion>
    <productParameter idref="productParameter1">
  </offspringDispersion>
  <epidemicTree>
    <starTreeModel idref="starTreeModel7">
  </epidemicTree>
</emergingEpidemic>

<empiricalCodonModel> element

This element represents the empirical model of codon evolution.

The element takes following attributes:

  • geneticCode (optional) is of type String
    “The genetic code to use”
  • ecmDataDir (optional) is of type String
    “The directory with the ECM data file”
  • ecmRateFile (optional) is of type String
    “The file with the ECM data matrix”
  • ecmFreqFile (optional) is of type String
    “The csv file with the ECM frequency matrix”

The element has the following contents:

  • Element named <omega>

    Containing:

  • One of:
    • Element named <kappaTsTv>

      Containing:

    • Element named <multiNtChange>

      Containing:

  • FrequencyModel element (zero or one)

Example:

<empiricalCodonModel geneticCode="universal" ecmDataDir="ecmdata" ecmRateFile="matrix.csv" ecmFreqFile="freqs.csv">
  <omega>
    <copyParameterValues idref="copyParameterValues4">
  </omega>
  <multiNtChange>
    <fastMatrixParameter idref="fastMatrixParameter7">
  </multiNtChange>
</empiricalCodonModel>

<empiricalDistributionLikelihood> element

Calculates the likelihood of some data given some empirically-generated distribution.

The element takes following attributes:

  • fileName is of type String
  • splineInterpolation (optional) is of type Boolean
  • degree (optional) is of type Integer
  • inverse (optional) is of type Boolean
  • readByColumn (optional) is of type Boolean

The element has the following contents:

  • Element named <data>

    Containing:

    • from (optional) is of type Integer
    • to (optional) is of type Integer
    • offset (optional) is of type Double
    • lower (optional) is of type Double
    • upper (optional) is of type Double
    • Statistic elements (one or more)

Example:

<empiricalDistributionLikelihood fileName="foo" splineInterpolation="true" degree="1" inverse="true" readByColumn="true">
  <data from="1" to="1" offset="1.0" lower="1.0" upper="1.0">
    <complementParameter idref="complementParameter3">
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix10">
    <thresholdStatistic idref="thresholdStatistic6">
  </data>
</empiricalDistributionLikelihood>

<empiricalPiecewise> element

This element represents a piecewise population model

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <intervalWidths>

    Containing:

  • Element named <populationSizes>
    The effective population sizes of each interval.

    Containing:

  • Element named <generationLength>
    The scale factor.

    Containing:

  • Element named <threshold>
    The threshold before counts occur.

    Containing:

  • Element named <lag>
    The lag between actual population sizes and genetic diversity.

    Containing:

Example:

<empiricalPiecewise units="generations">
  <intervalWidths values="0.5 1.0"/>
  <populationSizes>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter7">
  </populationSizes>
  <generationLength>
    <matrixParameter idref="matrixParameter2">
  </generationLength>
  <threshold>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
  </threshold>
  <lag>
    <differenceParameter idref="differenceParameter7">
  </lag>
</empiricalPiecewise>

<empiricalTreeDistributionModel> element

Read a list of trees from a NEXUS file.

The element takes following attributes:

  • startingTree (optional) is of type Integer
  • iterate (optional) is of type Boolean
  • fileName is of type String
    “The name of a NEXUS tree file”

The element has the following contents:

Example:

<empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
  <ascertainedPatterns from="1" to="1" every="1">
    <convert idref="convert9">
  </ascertainedPatterns>
</empiricalTreeDistributionModel>

<empiricalTreeDistributionOperator> element

Operator which switches between trees in an empirical distribution.

The element takes following attributes:

  • weight is of type Double
  • metropolisHastings (optional) is of type Boolean

The element has the following contents:

Example:

<empiricalTreeDistributionOperator weight="1.0" metropolisHastings="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <rescaledTree idref="rescaledTree10">
  </empiricalTreeDistributionModel>
</empiricalTreeDistributionOperator>

<epochBranchModel> element

This element provides a branch model which has multiple epoch. All branches (or portions of them) have the same substitution model within a given epoch. If parameters are used to sample transition times, these must be kept in ascending order by judicious use of bounds or priors.

The element has the following contents:

  • TreeModel element (exactly one)
    The tree across which the epochs will be assigned
  • SubstitutionModel element (exactly one)
    The ancestral substitution model after the last epoch
  • Element named <epoch>
    An epoch that lasts until transitionTime

    Containing:

    • transitionTime (optional) is of type Double
    “The time of transition between this epoch and the previous one”
    The substitution model for this epoch
    • Element named <transitionTime>
    The transition time parameter for this epoch
    Containing:
    
    * [Parameter](#parameter) element (exactly one)
    

Example:

<epochBranchModel>
  <treeModel fixHeights="true" fixTree="true">
    <rescaledTree idref="rescaledTree2">
    <rootHeight>
      <productParameter idref="productParameter3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <sumParameter idref="sumParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixMatrixProduct idref="matrixMatrixProduct10">
    </nodeHeights>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter10">
    </leafHeight>
    <leafHeight taxon="foo">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix9">
    </leafHeight>
    <leafHeight taxon="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter6">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <productParameter idref="productParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <leafTraitParameter idref="leafTraitParameter3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter3">
    </leafTrait>
  </treeModel>
  <complexSubstitutionModel dataType="hiddenCodon2-universal" randomizeIndicator="true" bssvsTolerance="1.0" bssvsScalar="1.0" checkConditioning="true" normalized="true">
    <rootFrequencies>
      <frequencyModel idref="frequencyModel3">
    </rootFrequencies>
    <rates/>
  </complexSubstitutionModel>
  <epoch transitionTime="1.0">
    <markovModulatedYangCodonModel idref="markovModulatedYangCodonModel3">
  </epoch>
  <epoch transitionTime="1.0">
    <pcaCodonModel idref="pcaCodonModel9">
  </epoch>
</epochBranchModel>

<exponentialStatistic> element

This element returns a statistic that is the element-wise exponentiation of the child statistic.

The element has the following contents:

Example:

<exponentialStatistic>
  <mvPolyaLikelihood>
    <data>
      <mvPolyaLikelihood idref="mvPolyaLikelihood5">
    </data>
    <alpha>
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </alpha>
  </mvPolyaLikelihood>
</exponentialStatistic>

<expansion> element

A demographic model of constant population size followed by exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <ancestralPopulationProportion>

    Containing:

  • One of:

    • Element named <growthRate>
      A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.

      Containing:

    • Element named <doublingTime>
      This parameter determines the doubling time.

      Containing:

Example:

<expansion units="substitutions">
  <populationSize>
    <dataFromTreeTips idref="dataFromTreeTips7">
  </populationSize>
  <ancestralPopulationProportion>
    <mvPolyaLikelihood idref="mvPolyaLikelihood8">
  </ancestralPopulationProportion>
  <growthRate>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView9">
  </growthRate>
</expansion>

<expConstExp> element

A demographic model of exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <relativePlateauSize>
    The size of plateau relative to modern population size.

    Containing:

  • Element named <relTimeModGrowth>
    The time spanned by modern growth phase relative to time back to start of plateau phase.

    Containing:

  • Element named <plateauStartTime>
    The time of the start of plateauPhase.

    Containing:

  • Element named <ancientGrowthRate>
    The growth rate of early growth phase

    Containing:

Example:

<expConstExp units="generations">
  <populationSize>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
  </populationSize>
  <relativePlateauSize>
    <vectorSlice idref="vectorSlice8">
  </relativePlateauSize>
  <relTimeModGrowth>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter1">
  </relTimeModGrowth>
  <plateauStartTime>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
  </plateauStartTime>
  <ancientGrowthRate>
    <fastMatrixParameter idref="fastMatrixParameter2">
  </ancientGrowthRate>
</expConstExp>

<exponentialDistributionModel> element

A model of an exponential distribution.

The element takes following attributes:

  • offset (optional) is of type Double

The element has the following contents:

  • One of:
    • Element named <mean>

      Containing:

      • Double element (exactly one)
    • Element named <mean>

      Containing:

Example:

<exponentialDistributionModel offset="1.0">
  <mean>
    <fastMatrixParameter idref="fastMatrixParameter1">
  </mean>
</exponentialDistributionModel>

<exponentialExponential> element

A demographic model of exponential growth followed by a different exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <growthRate>

    Containing:

  • Element named <ancestralGrowthRate>

    Containing:

  • Element named <transitionTime>

    Containing:

Example:

<exponentialExponential units="years">
  <populationSize>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser9">
  </populationSize>
  <growthRate>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
  </growthRate>
  <ancestralGrowthRate>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
  </ancestralGrowthRate>
  <transitionTime>
    <fastMatrixParameter idref="fastMatrixParameter4">
  </transitionTime>
</exponentialExponential>

<exponentialGrowth> element

A demographic model of exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • One of:

    • Element named <growthRate>
      A value of zero represents a constant population size, negative values represent decline towards the present, positive numbers represents exponential growth towards the present. A random walk operator is recommended for this parameter with a starting value of 0.0 and no upper or lower limits.

      Containing:

    • Element named <doublingTime>
      This parameter determines the doubling time.

      Containing:

Example:

<exponentialGrowth units="substitutions">
  <populationSize>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter3">
  </populationSize>
  <doublingTime>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
  </doublingTime>
</exponentialGrowth>

<exponentialLogistic> element

A demographic model of exponential growth followed by logistic growth.

The element takes following attributes:

  • units is of type String
    “the units”
  • alpha is of type Double

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <logisticGrowthRate>

    Containing:

  • Element named <logisticShape>

    Containing:

  • Element named <exponentialGrowthRate>

    Containing:

  • Element named <transitionTime>

    Containing:

Example:

<exponentialLogistic units="years" alpha="1.0">
  <populationSize>
    <dataFromTreeTips idref="dataFromTreeTips9">
  </populationSize>
  <logisticGrowthRate>
    <leafTraitParameter idref="leafTraitParameter1">
  </logisticGrowthRate>
  <logisticShape>
    <dataFromTreeTips idref="dataFromTreeTips1">
  </logisticShape>
  <exponentialGrowthRate>
    <dataFromTreeTips idref="dataFromTreeTips5">
  </exponentialGrowthRate>
  <transitionTime>
    <copyParameterValues idref="copyParameterValues3">
  </transitionTime>
</exponentialLogistic>

<exponentialMarkovLikelihood> element

A continuous state, discrete time markov chain in which each new state is an exponentially distributed variable with a mean of the previous state.

The element takes following attributes:

  • jeffreys (optional) is of type Boolean
  • reverse (optional) is of type Boolean

The element has the following contents:

  • Element named <chainParameter>

    Containing:

Example:

<exponentialMarkovLikelihood jeffreys="true" reverse="true">
  <chainParameter>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </chainParameter>
</exponentialMarkovLikelihood>

<exponentialPrior> element

Calculates the prior probability of some data under a given exponential distribution.

The element takes following attributes:

  • offset (optional) is of type Double

The element has the following contents:

Example:

<exponentialPrior mean="1.0" offset="1.0">
  <gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood1">
  </gmrfPopSizeStatistic>
</exponentialPrior>

<exponentialSawtooth> element

A demographic model of succesive exponential growth and periodic population crashes.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <growthRate>
    The rate of exponential growth during the growth phase.

    Containing:

  • Element named <wavelength>
    The wavelength between successive population crashes.

    Containing:

  • Element named <offset>
    The proportion of the last growth phase that is not achieved at the final sample time.

    Containing:

Example:

<exponentialSawtooth units="years">
  <populationSize>
    <diagonalMatrix idref="diagonalMatrix8">
  </populationSize>
  <growthRate>
    <matrixVectorProductParameter idref="matrixVectorProductParameter2">
  </growthRate>
  <wavelength>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
  </wavelength>
  <offset>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter7">
  </offset>
</exponentialSawtooth>

<exponentialStatistic> element

This element returns a statistic that is the element-wise exponentiation of the child statistic.

The element has the following contents:

Example:

<exponentialStatistic>
  <nodeHeightsStatistic name="foo">
    <starTreeModel idref="starTreeModel7">
  </nodeHeightsStatistic>
</exponentialStatistic>

<expressionStatistic> element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

  • Element named <expression>

    Containing:

    • String element (exactly one)
  • Element named <variables>

    Containing:

Example:

<expressionStatistic>
  <expression>
    foo
  </expression>
  <variables>
    <gmrfPopSizeStatistic idref="gmrfPopSizeStatistic3">
    <duplicatedParameter idref="duplicatedParameter6">
  </variables>
</expressionStatistic>

<extendedDataType> element

This element represents an instance of the MutationDeathType which extends a base datatype with an additional “death” state.

The element takes following attributes:

  • dataType (optional) is of type String
    “Base datatype name”

The element has the following contents:

  • DataType element (zero or one)

  • Element named <deathState>

    Containing:

  • Element named <extantState>

    Containing:

: Example:

<extendedDataType dataType="codon-echinodermMitochondrial"/>

<externalInternalBranchModel> element

This element provides a branch model which allows different substitution modelson internal and external branches of the tree.

The element has the following contents:

  • TreeModel element (exactly one)
    The tree
  • SubstitutionModel element (exactly one)
    The substitution model for internal branches
  • Element named <externalBranches>

    Containing:

Example:

<externalInternalBranchModel>
  <starTreeModel>
    <argTreeModel idref="argTreeModel10">
    <rootHeight>
      <dataFromTreeTips idref="dataFromTreeTips5">
    </rootHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix5">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundParameter idref="compoundParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter6">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <copyParameterValues idref="copyParameterValues3">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
    </leafTrait>
  </starTreeModel>
  <empiricalCodonModel geneticCode="invertebrateMitochondrial" ecmDataDir="ecmdata" ecmRateFile="matrix.csv" ecmFreqFile="freqs.csv">
    <omega>
      <productParameter idref="productParameter5">
    </omega>
    <multiNtChange>
      <diagonalMatrix idref="diagonalMatrix1">
    </multiNtChange>
  </empiricalCodonModel>
  <externalBranches>
    <aminoAcidModel idref="aminoAcidModel9">
  </externalBranches>
</externalInternalBranchModel>

<externalLengthStatistic> element

A statistic that has as its value(s) the length of the external branch length(s) of a set of one or more taxa in a given tree

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic primarily for the purposes of logging”

The element has the following contents:

Example:

<externalLengthStatistic name="foo">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork5">
    <rootHeight>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
    </nodeHeights>
    <leafHeight taxon="foo">
      <designMatrix idref="designMatrix2">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <immutableParameter idref="immutableParameter6">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <compoundMatrixParameter idref="compoundMatrixParameter4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <diagonalMatrix idref="diagonalMatrix4">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <vectorSlice idref="vectorSlice7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues7">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix9">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <fastMatrixParameter idref="fastMatrixParameter9">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak8">
    </outbreak>
  </partitionedTreeModel>
  <taxa>
    <apsp idref="apsp5">
    <apsp idref="apsp5">
  </taxa>
</externalLengthStatistic>

<fastBlockUpperTriangularMatrixParameterParser> element

Returns a blockUpperTriangularMatrixParameter which is a compoundParameter which forces the last element to be of full length, the second to last element to be of full length-1, etc.

The element takes following attributes:

  • transpose (optional) is of type Boolean
  • columns (optional) is of type Integer
  • rows (optional) is of type Integer

Example:

<fastBlockUpperTriangularMatrixParameterParser transpose="true" columns="1" rows="1"/>

<fastMatrixParameter> element

A fast matrix parameter constructed from a single parameter.

The element takes following attributes:

The element has the following contents:

Example:

<fastMatrixParameter rows="1" columns="1">
  <fastBlockUpperTriangularMatrixParameterParser transpose="true" columns="1" rows="1"/>
  <jointParameter>
    <maskedMatrixParameter idref="maskedMatrixParameter6">
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter3">
  </jointParameter>
  <compoundParameter>
    <differenceParameter idref="differenceParameter4">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter7">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    <diagonalMatrix idref="diagonalMatrix9">
  </compoundParameter>
</fastMatrixParameter>

<fireParameterChanged> element

This element returns a operator that forces the entire model likelihood recomputation

The element takes following attributes:

The element has the following contents:

Example:

<fireParameterChanged weight="1.0">
  <vectorSlice sliceDimension="1">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter1">
    <leafTraitParameter idref="leafTraitParameter8">
    <parameter idref="parameter8">
  </vectorSlice>
</fireParameterChanged>

<fixedDriftModel> element

This element returns a relaxed drift model.

The element has the following contents:

  • Element named <backboneDrift>
    backbone drift rate

    Containing:

  • Element named <otherDrift>
    other drift rate

    Containing:

Example:

<fixedDriftModel>
  <backboneDrift>
    <fastMatrixParameter idref="fastMatrixParameter9">
  </backboneDrift>
  <otherDrift>
    <productParameter idref="productParameter3">
  </otherDrift>
</fixedDriftModel>

<FixedNodeheightSubtreePruneRegraft> element

This element represents a FNPR operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

The element has the following contents:

Example:

<FixedNodeheightSubtreePruneRegraft weight="1.0">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <upgmaTree idref="upgmaTree9">
    <rootHeight>
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter8">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <leafTraitParameter idref="leafTraitParameter6">
    </nodeHeights>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter6">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundMatrixParameter idref="compoundMatrixParameter7">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak3">
    </outbreak>
  </partitionedTreeModel>
</FixedNodeheightSubtreePruneRegraft>

<flatGeoSpatialPrior> element

Calculates the likelihood of some data under a 2D geospatial distribution.

The element takes following attributes:

  • taxon (optional) is of type String
  • inside (optional) is of type Boolean
  • union (optional) is of type Boolean
  • cache (optional) is of type Boolean

The element has the following contents:

  • One of:
  • Element named <data>

    Containing:

Example:

<flatGeoSpatialPrior taxon="foo" inside="true" union="true" cache="true" kmlFileName="foo">
  <data>
    <compoundParameter idref="compoundParameter6">
    <matrixParameter idref="matrixParameter10">
    <jointParameter idref="jointParameter9">
  </data>
</flatGeoSpatialPrior>

<frequencyModel> element

A model of equilibrium base frequencies.

The element takes following attributes:

  • composition (optional) is of type String
    “Composition type”
  • normalize (optional) is of type Boolean
  • compress (optional) is of type Boolean

The element has the following contents:

  • PatternList element (zero or one)
    Initial value
  • One of:
    • dataType is of type String
      “The type of sequence data”
    • DataType element (exactly one)
  • Element named <frequencies>

    Containing:

Example:

<frequencyModel composition="3x4" normalize="true" compress="true" dataType="codon-mycoplasma">
  <frequencies>
    <matrixMatrixProduct idref="matrixMatrixProduct5">
  </frequencies>
</frequencyModel>

<gammaDistributionModel> element

The gamma probability distribution.

The element takes following attributes:

  • offset (optional) is of type Double

The element has the following contents:

  • Element named <shape>
    Shape parameter

    Containing:

  • Element named <scale>
    Scale parameter

    Containing:

  • Element named <rate>
    Rate parameter

    Containing:

  • Element named <mean>
    Mean parameter

    Containing:

Example:

<gammaDistributionModel offset="1.0">
  <shape/>
</gammaDistributionModel>

<gammaPrior> element

Calculates the prior probability of some data under a given gamma distribution.

The element takes following attributes:

The element has the following contents:

Example:

<gammaPrior shape="1.0" scale="1.0" offset="1.0">
  <monotonicStatistic order="foo" strictlyMonotic="true">
    <diagonalMatrix idref="diagonalMatrix3">
    <differenceStatistic idref="differenceStatistic8">
    <treeLengthStatistic idref="treeLengthStatistic8">
    <copyParameterValues idref="copyParameterValues1">
  </monotonicStatistic>
  <subStatistic dimension="1 2 4 8">
    <matrixParameter idref="matrixParameter4">
  </subStatistic>
  <elementWiseMatrixMultiplicationParameter/>
</gammaPrior>

<gammaReferencePrior> element

Calculates the reference prior probability of some data under a given normal distribution.

The element takes following attributes:

The element has the following contents:

Example:

<gammaReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <negativeStatistic>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser10">
  </negativeStatistic>
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood8">
  </continuousDiffusionStatistic>
</gammaReferencePrior>

<gammaReferencePrior> element

Calculates the reference prior probability of some data under a given normal distribution.

The element takes following attributes:

The element has the following contents:

Example:

<gammaReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <complementParameter>
    <mvPolyaLikelihood idref="mvPolyaLikelihood9">
  </complementParameter>
  <parameter value="0.5 1.0" dimension="1" fileName="foo" parameterColumn="foo" burnin="1" upper="0.5 1.0" lower="0.5 1.0"/>
</gammaReferencePrior>

<gaussianProcessFromTree> element

Returns a random draw of traits given a trait model and a prior

The element has the following contents:

Example:

<gaussianProcessFromTree>
  ERROR!
</gaussianProcessFromTree>

<gaussianProcessOperator> element

This element returns a multivariate normal random walk operator on a given parameter.

The element takes following attributes:

  • scaleFactor is of type Double
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • translationInvariant (optional) is of type Boolean
  • rotationInvariant (optional) is of type Boolean

The element has the following contents:

Example:

<gaussianProcessOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" translationInvariant="true" rotationInvariant="true">
  <buildCompoundSymmetricMatrix/>
  <normalDistributionModel>
    <mean>
      1.0
    </mean>
    <precision>
      <differenceParameter idref="differenceParameter9">
    </precision>
  </normalDistributionModel>
</gaussianProcessOperator>

<generalDataType> element

Defines a general DataType for any number of states

The element has the following contents:

:

Example:

<!-- The XML for a nucleotide data type under this scheme would be -->
<generalDataType id="nucleotides">
	<state code="A"/>
	<state code="C"/>
	<state code="G"/>
	<state code="T"/>
	<alias code="U" state="T"/>
	<ambiguity code="R" states="AG"/>
	<ambiguity code="Y" states="CT"/>
	<ambiguity code="?" states="ACGT"/>
	<ambiguity code="-" states="ACGT"/>
</generalDataType>

<generalizedSkylineGibbsOperator> element

This element returns a Gibbs operator for the joint distribution of population sizes.

The element takes following attributes:

  • linear (optional) is of type Boolean
  • weight is of type Double
  • lower is of type Double
  • upper is of type Double
  • Jeffreys (optional) is of type Boolean
  • reverse (optional) is of type Boolean
  • exponentialMarkov (optional) is of type Boolean
  • shape is of type Double

The element has the following contents:

Example:

<generalizedSkylineGibbsOperator linear="true" weight="1.0" lower="1.0" upper="1.0" Jeffreys="true" reverse="true" exponentialMarkov="true" shape="1.0">
  <generalizedSkyLineLikelihood linear="true">
    <populationSizes>
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </populationSizes>
    <groupSizes>
      <jointParameter idref="jointParameter6">
    </groupSizes>
    <populationTree>
      <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
    </populationTree>
  </generalizedSkyLineLikelihood>
  <matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter4">
  </matrixParameter>
</generalizedSkylineGibbsOperator>

<generalizedSkyLineLikelihood> element

This element represents the likelihood of the tree given the population size vector.

The element has the following contents:

  • One of:
  • Element named <populationSizes>

    Containing:

  • Element named <groupSizes>

    Containing:

  • Element named <populationTree>

    Containing:

Example:

<generalizedSkyLineLikelihood linear="true">
  <populationSizes>
    <fastMatrixParameter idref="fastMatrixParameter7">
  </populationSizes>
  <groupSizes>
    <mvPolyaLikelihood idref="mvPolyaLikelihood1">
  </groupSizes>
  <populationTree>
    <starTreeModel idref="starTreeModel2">
  </populationTree>
</generalizedSkyLineLikelihood>

<generalizedSkylinePopSizeStatistic> element

The pop sizes at the given times

Example:

<generalizedSkylinePopSizeStatistic/>

<generalizedSteppingStoneSamplingAnalysis> element

Performs a trace analysis.

The element takes following attributes:

  • fileName is of type String
    “The traceName of a BEAST log file (can not include trees, which should be logged separately)”
  • resultsFileName (optional) is of type String
    “The name of the output file to which the generalized stepping-stone sampling estimate will be written”

The element has the following contents:

  • Element named <thetaColumn>

    Containing:

    • name is of type String
      “The column name”
  • Element named <sourceColumn>

    Containing:

    • name is of type String
      “The column name”
  • Element named <destinationColumn>

    Containing:

    • name is of type String
      “The column name”

Example:

<generalizedSteppingStoneSamplingAnalysis fileName="foo" resultsFileName="foo">
  <thetaColumn name="foo"/>
  <sourceColumn name="foo"/>
  <destinationColumn name="foo"/>
</generalizedSteppingStoneSamplingAnalysis>

<generalSubstitutionModel> element

A general reversible model of sequence substitution for any data type.

The element takes following attributes:

  • randomizeIndicator (optional) is of type Boolean

The element has the following contents:

  • One of:
    • dataType is of type String
      “The type of sequence data”
    • DataType element (exactly one)
  • Element named <frequencies>

    Containing:

  • Element named <rates>

    Containing:

  • Element named <rateIndicator>

    Containing:

Example:

<generalSubstitutionModel randomizeIndicator="true">
  <hiddenNucleotides classCount="1"/>
  <frequencies>
    <frequencyModel idref="frequencyModel3">
  </frequencies>
  <rates>
    <vectorSlice idref="vectorSlice2">
  </rates>
</generalSubstitutionModel>

<geoDistributionCollection> element

An operator that picks new parameter values uniformly at random.

The element has the following contents:

Example:

<geoDistributionCollection>
  <multivariateNormalPrior>
    <meanParameter>
      <compoundMatrixParameter idref="compoundMatrixParameter2">
    </meanParameter>
    <precisionParameter>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    </precisionParameter>
    <composedTransform idref="composedTransform4">
  </multivariateNormalPrior>
  <dirichletPrior alpha="0.5 1.0" sumsTo="1.0">
    <ratioStatistic idref="ratioStatistic1">
    <popGraph idref="popGraph8">
    <reciprocalStatistic idref="reciprocalStatistic5">
  </dirichletPrior>
  <multivariateDistributionLikelihood dataAsMatrix="true">
    <distribution>
      <treeTraitNormalDistribution idref="treeTraitNormalDistribution8">
    </distribution>
    <transform idref="transform2">
    <inverseTransform idref="inverseTransform10">
  </multivariateDistributionLikelihood>
  ERROR!
</geoDistributionCollection>

<GibbsIndependentCoalescentOperator> element

This element returns an independence coalescent sampler, disguised as a Gibbs operator, from a demographic model.

The element takes following attributes:

The element has the following contents:

Example:

<GibbsIndependentCoalescentOperator weight="1.0">
  <taxa>
    <taxa idref="taxa5">
  </taxa>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <partitionedTreeModel idref="partitionedTreeModel3">
    <rootHeight>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser3">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter3">
    </nodeHeights>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter7">
    </leafHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix2">
    </leafHeight>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter8">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix2">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <immutableParameter idref="immutableParameter3">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter6">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </nodeRates>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak3">
    </outbreak>
  </partitionedTreeModel>
  <constantLogistic units="years" alpha="1.0">
    <populationSize>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView4">
    </populationSize>
    <ancestralPopulationSize>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </ancestralPopulationSize>
    <growthRate>
      <parameter idref="parameter6">
    </growthRate>
    <shape>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
    </shape>
  </constantLogistic>
  <coalescentLikelihood>
    <model>
      <transmissionModel idref="transmissionModel8">
    </model>
    <populationTree factor="1.0">
      <starTreeModel idref="starTreeModel8">
    </populationTree>
    <populationTree factor="1.0">
      <treeModel idref="treeModel5">
    </populationTree>
    <populationTree factor="1.0">
      <treeModel idref="treeModel10">
    </populationTree>
  </coalescentLikelihood>
</GibbsIndependentCoalescentOperator>

<GibbsIndependentGammaOperator> element

This element returns an independence sampler, disguised as a Gibbs operator, from a provided gamma prior.

The element takes following attributes:

The element has the following contents:

Example:

<GibbsIndependentGammaOperator weight="1.0" shape="1.0" scale="1.0">
  <hiddenClassRewardParameter class="1" name="foo">
    <markovModulatedSubstitutionModel idref="markovModulatedSubstitutionModel8">
  </hiddenClassRewardParameter>
</GibbsIndependentGammaOperator>

<GibbsIndependentNormalDistributionOperator> element

This element returns an independence sampler, disguised as a Gibbs operator, from a provided normal distribution model.

The element takes following attributes:

The element has the following contents:

Example:

<GibbsIndependentNormalDistributionOperator weight="1.0">
  <normalDistributionModel>
    <mean>
      <parameter idref="parameter10">
    </mean>
    <precision>
      <duplicatedParameter idref="duplicatedParameter1">
    </precision>
  </normalDistributionModel>
  <compoundMatrixParameter>
    <mvPolyaLikelihood idref="mvPolyaLikelihood5">
    <dataFromTreeTips idref="dataFromTreeTips7">
    <maskedMatrixParameter idref="maskedMatrixParameter3">
  </compoundMatrixParameter>
</GibbsIndependentNormalDistributionOperator>

<GibbsPruneAndRegraft> element

This element represents a Gibbs sampler implemented through a prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution which is the proportion of the likelihoods of the proposals.

The element takes following attributes:

The element has the following contents:

Example:

<GibbsPruneAndRegraft weight="1.0" pruned="true">
  <treeModel fixHeights="true" fixTree="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
    <rootHeight>
      <differenceParameter idref="differenceParameter2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundParameter idref="compoundParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter6">
    </nodeHeights>
    <leafHeight taxon="foo">
      <maskedParameter idref="maskedParameter10">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixParameter idref="matrixParameter6">
    </leafHeight>
    <leafHeight taxon="foo">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision3">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter5">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
    </nodeTraits>
    <leafTrait taxon="foo" name="foo">
      <duplicatedParameter idref="duplicatedParameter2">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <diagonalMatrix idref="diagonalMatrix10">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <productParameter idref="productParameter7">
    </leafTrait>
  </treeModel>
</GibbsPruneAndRegraft>

<gibbsSampleMissingTraitsOperator> element

This element returns an independence coalescent sampler from a demographic model.

The element takes following attributes:

  • weight is of type Double
  • traitName (optional) is of type String

The element has the following contents:

Example:

<gibbsSampleMissingTraitsOperator weight="1.0" traitName="foo">
  <newTreeDataLikelihood useAmbiguities="true" scalingScheme="foo">
    <maskedPatterns idref="maskedPatterns1">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
  </newTreeDataLikelihood>
  <fastMatrixParameter rows="1" columns="1">
    <immutableParameter idref="immutableParameter3">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter9">
    <parameter idref="parameter7">
    <parameter idref="parameter4">
  </fastMatrixParameter>
  <missingIndicator>
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix9">
  </missingIndicator>
</gibbsSampleMissingTraitsOperator>

<GibbsSubtreeSwap> element

This element represents a Gibbs wide exchange operator. This operator swaps two subtrees chosen to their posterior probaility.

The element takes following attributes:

The element has the following contents:

Example:

<GibbsSubtreeSwap weight="1.0" pruned="true">
  <starTreeModel>
    <rescaledTree idref="rescaledTree10">
    <rootHeight>
      <jointParameter idref="jointParameter1">
    </rootHeight>
    <leafHeight taxon="foo">
      <jointParameter idref="jointParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </leafHeight>
  </starTreeModel>
</GibbsSubtreeSwap>

<glmModel> element

Calculates the generalized linear model likelihood of the dependent parameters given one or more blocks of independent parameters and their design matrix.

The element takes following attributes:

  • family is of type String
  • checkIdentifiability (optional) is of type Boolean
  • checkFullRank (optional) is of type Boolean

The element has the following contents:

  • Element named <dependentVariables>

    Containing:

  • Element named <independentVariables>

    Containing:

  • Element named <randomEffects>

    Containing:

Example:

<glmModel family="foo" checkIdentifiability="true" checkFullRank="true">
  <independentVariables>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
  </independentVariables>
  <independentVariables>
    <designMatrix idref="designMatrix5">
  </independentVariables>
  <randomEffects>
    <productParameter idref="productParameter4">
  </randomEffects>
  <randomEffects>
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser5">
  </randomEffects>
</glmModel>

<glmModelNew> element

Calculates the generalized linear model likelihood of the dependent parameters given one or more blocks of independent parameters and their design matrix.

The element takes following attributes:

  • checkIdentifiability (optional) is of type Boolean
  • checkFullRank (optional) is of type Boolean

The element has the following contents:

  • Element named <model>

    Containing:

  • Element named <dependentVariables>

    Containing:

  • Element named <independentVariables>

    Containing:

  • Element named <randomEffects>

    Containing:

Example:

<glmModelNew checkIdentifiability="true" checkFullRank="true">
  <model linkFunction="foo">
    <scaledBetaDistributionModel idref="scaledBetaDistributionModel1">
  </model>
  <dependentVariables>
    <productParameter idref="productParameter8">
  </dependentVariables>
  <independentVariables>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix7">
  </independentVariables>
  <randomEffects>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
  </randomEffects>
  <randomEffects>
    <parameter idref="parameter6">
  </randomEffects>
</glmModelNew>

<glmSubstitutionModel> element

A general model of sequence substitution for any data type where the rates come from the generalized linear model.

The element has the following contents:

Example:

<glmSubstitutionModel dataType="codon-noStops">
  <rootFrequencies>
    <frequencyModel idref="frequencyModel8">
  </rootFrequencies>
  <multivariateOUModel>
    <positiveDefiniteSubstitutionModel idref="positiveDefiniteSubstitutionModel7">
    <maskedMatrixParameter idref="maskedMatrixParameter3">
    <data>
      <sumParameter idref="sumParameter9">
    </data>
    <times>
      <matrixVectorProductParameter idref="matrixVectorProductParameter10">
    </times>
    <design>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    </design>
    <independentVariables>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix5">
    </independentVariables>
  </multivariateOUModel>
</glmSubstitutionModel>

<glmSubstitutionModelNew> element

A general model of sequence substitution for any data type where the rates come from the generalized linear model.

The element has the following contents:

Example:

<glmSubstitutionModelNew dataType="hiddenAminoAcid1">
  <rootFrequencies>
    <frequencyModel idref="frequencyModel5">
  </rootFrequencies>
  <glmModelNew checkIdentifiability="true" checkFullRank="true">
    <model linkFunction="foo">
      <poissonDistributionModel idref="poissonDistributionModel9">
    </model>
    <dependentVariables>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix6">
    </dependentVariables>
    <independentVariables>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
    </independentVariables>
    <independentVariables>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
    </independentVariables>
    <randomEffects>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    </randomEffects>
    <randomEffects>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix1">
    </randomEffects>
  </glmModelNew>
</glmSubstitutionModelNew>

<gmrfBivariateCurveAnalysis> element

Integrates two curves

The element takes following attributes:

Example:

<gmrfBivariateCurveAnalysis fileName1="foo" fileName2="foo" endTime="foo" burnIn="1"/>

<gmrfBlockUpdateOperator> element

This element returns a GMRF block-update operator for the joint distribution of the population sizes and precision parameter.

The element takes following attributes:

  • scaleFactor is of type Double
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • stopValue (optional) is of type Double
  • maxIterations (optional) is of type Integer
  • oldSkyride (optional) is of type Boolean

The element has the following contents:

Example:

<gmrfBlockUpdateOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" stopValue="1.0" maxIterations="1" oldSkyride="true">
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision3">
    </populationSizes>
    <precisionParameter>
      <productParameter idref="productParameter9">
    </precisionParameter>
    <populationTree>
      <starTreeModel idref="starTreeModel3">
    </populationTree>
  </gmrfSkyrideLikelihood>
</gmrfBlockUpdateOperator>

<gmrfFixedEffectsGibbsOperator> element

This element returns a Gibbs operator for regression coefficients in a GMRF.

The element takes following attributes:

The element has the following contents:

Example:

<gmrfFixedEffectsGibbsOperator weight="1.0">
  <treeTraitNormalDistributionLikelihood>
    <treeTraitNormalDistribution idref="treeTraitNormalDistribution10">
    <data>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter9">
      <compoundParameter idref="compoundParameter5">
      <diagonalMatrix idref="diagonalMatrix10">
      <designMatrix idref="designMatrix4">
    </data>
  </treeTraitNormalDistributionLikelihood>
  <elementWiseMatrixMultiplicationParameter/>
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <matrixParameter idref="matrixParameter8">
    </populationSizes>
    <precisionParameter>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </precisionParameter>
    <populationTree>
      <partitionedTreeModel idref="partitionedTreeModel10">
      <partitionedTreeModel idref="partitionedTreeModel4">
      <partitionedTreeModel idref="partitionedTreeModel7">
      <treeModel idref="treeModel9">
    </populationTree>
  </gmrfSkyrideLikelihood>
</gmrfFixedEffectsGibbsOperator>

<gmrfBlockUpdateOperator> element

This element returns a GMRF block-update operator for the joint distribution of the population sizes and precision parameter.

The element takes following attributes:

  • scaleFactor is of type Double
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • stopValue (optional) is of type Double
  • maxIterations (optional) is of type Integer
  • oldSkyride (optional) is of type Boolean

The element has the following contents:

Example:

<gmrfBlockUpdateOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" stopValue="1.0" maxIterations="1" oldSkyride="true">
  <gmrfTestLikelihood>
    <populationSizes>
      <duplicatedParameter idref="duplicatedParameter5">
    </populationSizes>
    <precisionParameter>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter5">
    </precisionParameter>
    <lambdaParameter>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision8">
    </lambdaParameter>
  </gmrfTestLikelihood>
</gmrfBlockUpdateOperator>

<gmrfHeightsStatistic> element

A statistic that returns the heights of each internal node in increasing order (or groups them by a group size parameter)

The element takes following attributes:

  • name (optional) is of type String

The element has the following contents:

Example:

<gmrfHeightsStatistic name="foo">
  <gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
    <populationSizes>
      <matrixParameter idref="matrixParameter3">
    </populationSizes>
    <precisionParameter>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </precisionParameter>
    <populationTree>
      <partitionedTreeModel idref="partitionedTreeModel10">
    </populationTree>
  </gmrfSkyrideLikelihood>
</gmrfHeightsStatistic>

<gmrfPopSizeStatistic> element

The pop sizes at the given times

The element takes following attributes:

  • from (optional) is of type Double
  • to (optional) is of type Double
  • number (optional) is of type Integer
  • time (optional) is of type Double;

The element has the following contents:

Example:

<gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
  <gmrfTestLikelihood>
    <populationSizes>
      <compoundMatrixParameter idref="compoundMatrixParameter6">
    </populationSizes>
    <precisionParameter>
      <differenceMatrixParameter idref="differenceMatrixParameter2">
    </precisionParameter>
    <lambdaParameter>
      <designMatrix idref="designMatrix2">
    </lambdaParameter>
  </gmrfTestLikelihood>
</gmrfPopSizeStatistic>

<gmrfSkyrideLikelihood> element

This element represents the likelihood of the tree given the population size vector.

The element takes following attributes:

  • rescaleByRootHeight (optional) is of type Boolean
  • randomizeTree (optional) is of type Boolean
  • timeAwareSmoothing (optional) is of type Boolean
  • oldSkyride (optional) is of type Boolean

The element has the following contents:

  • Element named <populationSizes>

    Containing:

  • Element named <precisionParameter>

    Containing:

  • Element named <phiParameter>

    Containing:

  • Element named <populationTree>

    Containing:

  • Element named <groupSizes>

    Containing:

  • Element named <singleBeta>

    Containing:

Example:

<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
  <populationSizes>
    <compoundParameter idref="compoundParameter5">
  </populationSizes>
  <precisionParameter>
    <leafTraitParameter idref="leafTraitParameter9">
  </precisionParameter>
  <populationTree>
    <treeModel idref="treeModel5">
    <partitionedTreeModel idref="partitionedTreeModel10">
    <partitionedTreeModel idref="partitionedTreeModel7">
  </populationTree>
</gmrfSkyrideLikelihood>

<gmrfSkyrideLikelihood> element

This element represents the likelihood of the tree given the population size vector.

The element takes following attributes:

  • rescaleByRootHeight (optional) is of type Boolean
  • randomizeTree (optional) is of type Boolean
  • timeAwareSmoothing (optional) is of type Boolean
  • oldSkyride (optional) is of type Boolean

The element has the following contents:

  • Element named <populationSizes>

    Containing:

  • Element named <precisionParameter>

    Containing:

  • Element named <phiParameter>

    Containing:

  • Element named <populationTree>

    Containing:

  • Element named <groupSizes>

    Containing:

  • Element named <singleBeta>

    Containing:

Example:

<gmrfSkyrideLikelihood rescaleByRootHeight="true" randomizeTree="true" timeAwareSmoothing="true" oldSkyride="true">
  <populationSizes>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
  </populationSizes>
  <precisionParameter>
    <immutableParameter idref="immutableParameter4">
  </precisionParameter>
  <populationTree>
    <partitionedTreeModel idref="partitionedTreeModel4">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel2">
  </populationTree>
</gmrfSkyrideLikelihood>

<gmrfTestLikelihood> element

This element represents the likelihood of the tree given the population size vector.

The element has the following contents:

  • Element named <populationSizes>

    Containing:

  • Element named <precisionParameter>

    Containing:

  • Element named <lambdaParameter>

    Containing:

Example:

<gmrfTestLikelihood>
  <populationSizes>
    <differenceMatrixParameter idref="differenceMatrixParameter5">
  </populationSizes>
  <precisionParameter>
    <matrixVectorProductParameter idref="matrixVectorProductParameter1">
  </precisionParameter>
  <lambdaParameter>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
  </lambdaParameter>
</gmrfTestLikelihood>

<gradient> element

null

The element has the following contents:

Example:

<gradient>
  <multivariateNormalPrior>
    <meanParameter>
      <maskedParameter idref="maskedParameter3">
    </meanParameter>
    <precisionParameter>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView3">
    </precisionParameter>
  </multivariateNormalPrior>
</gradient>

<greatCircleDiffusionModel> element

Describes a bivariate diffusion process using great circle distances.

The element has the following contents:

  • Parameter element (exactly one)

  • Element named <diffusionCoefficient>

    Containing:

Example:

<greatCircleDiffusionModel>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <mvPolyaLikelihood idref="mvPolyaLikelihood10">
  </maskedMatrixParameter>
</greatCircleDiffusionModel>

<gtrModel> element

A general reversible model of nucleotide sequence substitution.

The element has the following contents:

  • Element named <frequencies>

    Containing:

  • Element named <rates>

    Containing:

  • Element named <rateAC>

    Containing:

  • Element named <rateAG>

    Containing:

  • Element named <rateAT>

    Containing:

  • Element named <rateCG>

    Containing:

  • Element named <rateCT>

    Containing:

  • Element named <rateGT>

    Containing:

Example:

<!-- A general time reversible model for DNA.                                          -->
<!-- This element must have parameters for exactly five of the six rates               -->
<!-- The sixth rate has an implied value of 1.0 and all other rates are relative to it -->
<!-- This example parameterizes the rate matrix relative to the A<->G transition       -->
<gtrModel id="gtr1">
	<frequencies> <frequencyModel idref="freqs"/> </frequencies>
	<rateAC> <parameter id="rateAC" value="1.0"/> </rateAC>
	<rateAT> <parameter id="rateAT" value="1.0"/> </rateAT>
	<rateCG> <parameter id="rateCG" value="1.0"/> </rateCG>
	<rateCT> <parameter id="rateCT" value="1.0"/> </rateCT>
	<rateGT> <parameter id="rateGT" value="1.0"/> </rateGT>
</gtrModel>

<halfNormalPrior> element

Calculates the prior probability of some data under a given half-normal distribution.

The element takes following attributes:

The element has the following contents:

Example:

<halfNormalPrior mean="1.0" stdev="1.0">
  <gmrfPopSizeStatistic from="1.0" to="1.0" number="1" time="0.5 1.0">
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood3">
  </gmrfPopSizeStatistic>
  <treeMetricStatistic name="foo" type="foo">
    <target>
      <treeModel idref="treeModel6">
    </target>
    <reference>
      <neighborJoiningTree idref="neighborJoiningTree8">
    </reference>
  </treeMetricStatistic>
  <argReassortmentNodeCount name="foo">
    <argTreeModel idref="argTreeModel4">
  </argReassortmentNodeCount>
</halfNormalPrior>

<halfTPrior> element

Calculates the prior probability of some data under a given half-T distribution.

The element takes following attributes:

The element has the following contents:

Example:

<halfTPrior scale="1.0" df="1.0">
  <diffusionRateCovarianceStatistic name="foo" greatCircleDistance="true" diffusionCoefficient="true">
    <starTreeModel idref="starTreeModel2">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood6">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood3">
    <inhibitionLikelihood idref="inhibitionLikelihood8">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood2">
  </diffusionRateCovarianceStatistic>
</halfTPrior>

<HamiltonianMonteCarloOperator> element

Returns a Hamiltonian Monte Carlo transition kernel

The element takes following attributes:

The element has the following contents:

Example:

<HamiltonianMonteCarloOperator weight="1.0" nSteps="1" stepSize="1.0" drawVariance="1.0" autoOptimize="true" mode="1">
  <approximateFactorAnalysisPrecision>
    <L>
      <designMatrix idref="designMatrix9">
    </L>
    <gamma>
      <matrixParameter idref="matrixParameter10">
    </gamma>
  </approximateFactorAnalysisPrecision>
  <gradient>
    <multivariateNormalPrior idref="multivariateNormalPrior2">
  </gradient>
</HamiltonianMonteCarloOperator>

<harmonicMeanAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

  • fileName is of type String
    “The traceName of a BEAST log file (can not include trees, which should be logged separately”
  • burnIn (optional) is of type Integer
  • bootstrapLength (optional) is of type Integer
  • smoothedEstimate (optional) is of type Boolean

The element has the following contents:

  • Element named <likelihoodColumn>

    Containing:

    • name is of type String
      “The column name”

Example:

<harmonicMeanAnalysis fileName="foo" burnIn="1" bootstrapLength="1" smoothedEstimate="true">
  <likelihoodColumn name="foo"/>
</harmonicMeanAnalysis>

<hiddenClassRewardParameter> element

Generates a reward parameter to log hidden classes in Markov-modulated substitutionProcess

The element takes following attributes:

The element has the following contents:

Example:

<hiddenClassRewardParameter class="1" name="foo">
  <markovModulatedSubstitutionModel dataType="foo" geometricRates="true" renormalize="true">
    <switchingRates>
      <fastMatrixParameter idref="fastMatrixParameter8">
    </switchingRates>
    <lewisMk idref="lewisMk5">
    <hkyModel idref="hkyModel9">
    <yangCodonModel idref="yangCodonModel6">
  </markovModulatedSubstitutionModel>
</hiddenClassRewardParameter>

<hiddenNucleotides> element

A nucleotide data type that allows hidden substitution classes

The element takes following attributes:

Example:

<hiddenNucleotides classCount="1"/>

<HierarchicalBitFlipOperator> element

This element returns a bit-flip operator on a set of hierarchical and strata parameters simulatneously.

The element takes following attributes:

  • weight is of type Double
  • usesPriorOnSum (optional) is of type Boolean

The element has the following contents:

  • Element named <hParameter>

    Containing:

  • Element named <strataParameters>

    Containing:

Example:

<HierarchicalBitFlipOperator weight="1.0" usesPriorOnSum="true">
  <hParameter>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
  </hParameter>
  <strataParameters>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter6">
    <matrixVectorProductParameter idref="matrixVectorProductParameter4">
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter10">
  </strataParameters>
</HierarchicalBitFlipOperator>

<hierarchicalGraphLikelihood> element

Calculates the likelihood of strata graph given hierarchical graph and p.

The element has the following contents:

  • Element named <hierarchicalIndicator>

    Containing:

  • Element named <strataIndicator>

    Containing:

  • Element named <prob>

    Containing:

Example:

<hierarchicalGraphLikelihood>
  <hierarchicalIndicator>
    <maskedMatrixParameter idref="maskedMatrixParameter3">
  </hierarchicalIndicator>
  <strataIndicator>
    <maskedMatrixParameter idref="maskedMatrixParameter10">
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix4">
    <parameter idref="parameter7">
    <jointParameter idref="jointParameter7">
  </strataIndicator>
  <prob>
    <matrixVectorProductParameter idref="matrixVectorProductParameter2">
  </prob>
</hierarchicalGraphLikelihood>

<hierarchicalPartitionLikelihood> element

null

The element has the following contents:

Example:

<hierarchicalPartitionLikelihood>
  <argTreeModel partitionType="reassortment">
    <rescaledTree idref="rescaledTree2">
    <rootHeight>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixMatrixProduct idref="matrixMatrixProduct5">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedParameter idref="maskedParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice6">
    </nodeHeights>
  </argTreeModel>
</hierarchicalPartitionLikelihood>

<hierarchicalTransmissionModel> element

A SiteModel that has a gamma distributed rates across sites

The element takes following attributes:

  • units is of type String
    “the units”
  • hostCount is of type Integer

The element has the following contents:

  • One of:
    • Element named <constant>

      Containing:

      • Element named <populationSize>
        This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.

        Containing:

    • One of:

      • Element named <exponential>

        Containing:

        • One of:
          • Element named <growthRate>
            This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.

            Containing:

          • Element named <doublingTime>
            This parameter determines the doubling time at peak growth rate.

            Containing:

        • Element named <ancestralProportion>
          This parameter determines the populaation size at transmission.

          Containing:

      • Element named <logistic>

        Containing:

        • Element named <populationSize>
          This parameter represents the carrying capacity (maximum population size). If the shape is very large then the current day population size will be very close to the carrying capacity.

          Containing:

        • One of:
          • Element named <growthRate>
            This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.

            Containing:

          • Element named <doublingTime>
            This parameter determines the doubling time at peak growth rate.

            Containing:

        • Element named <ancestralProportion>
          This parameter determines the populaation size at transmission.

          Containing:

Example:

<hierarchicalTransmissionModel units="generations" hostCount="1">
  <exponential>
    <doublingTime>
      <dataFromTreeTips idref="dataFromTreeTips3">
    </doublingTime>
    <ancestralProportion>
      <differenceParameter idref="differenceParameter5">
    </ancestralProportion>
  </exponential>
</hierarchicalTransmissionModel>

<historyFilter> element

A logger to filter transitions in the complete history.

The element takes following attributes:

  • maxTime (optional) is of type Double
  • minTime (optional) is of type Double

The element has the following contents:

  • Element named <sources>

    Containing:

  • Element named <destinations>

    Containing:

Example:

<historyFilter maxTime="1.0" minTime="1.0"/>

<hkyModel> element

This element represents an instance of the HKY85 (Hasegawa, Kishino & Yano, 1985) model of nucleotide evolution.

The element has the following contents:

  • Element named <frequencies>

    Containing:

  • Element named <kappa>

    Containing:

Example:

<hkyModel>
  <frequencies>
    <frequencyModel idref="frequencyModel8">
  </frequencies>
  <kappa>
    <maskedParameter idref="maskedParameter6">
  </kappa>
</hkyModel>

<hybPopSizesScaleOperator> element

Operator which scales the population size of a newly formed hybrid.

The element takes following attributes:

The element has the following contents:

Example:

<hybPopSizesScaleOperator weight="1.0" scaleFactor="1.0">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp2">
    <apsp idref="apsp8">
    <apsp idref="apsp6">
    <apsp idref="apsp9">
    <geneTrees>
      <starTreeModel idref="starTreeModel3">
      <partitionedTreeModel idref="partitionedTreeModel8">
      <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
      <gtree popfactor="1.0">
        <treeModel idref="treeModel7">
      </gtree>
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel7">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies6">
    <tipPopulations value="1.0">
      <differenceParameter idref="differenceParameter6">
    </tipPopulations>
    <rootPopulations value="1.0">
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision5">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <compoundParameter idref="compoundParameter8">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</hybPopSizesScaleOperator>

<hypermutantAlignment> element

Converts an alignment so that ‘A’s at specific APOBEC targeted contexts are set to an A/G ambiguity code.

The element takes following attributes:

  • type is of type String
    “The type of APOBEC molecule being modelled”

The element has the following contents:

Example:

<hypermutantAlignment type="hA3F">
  <sequenceSimulator replications="1">
    <newick idref="newick8">
    ERROR!
  </sequenceSimulator>
</hypermutantAlignment>

<hypermutantErrorModel> element

This element returns a model that allows for APOBEC-type RNA editing.

The element takes following attributes:

  • unlinkedRates (optional) is of type Boolean

The element has the following contents:

  • HypermutantAlignment element (exactly one)

  • Element named <hypermutationRate>
    The hypermutation rate per target site per sequence

    Containing:

  • Element named <hypermutationIndicators>
    A binary indicator of whether the sequence is hypermutated

    Containing:

Example:

<hypermutantErrorModel unlinkedRates="true">
  ERROR!
  <hypermutationRate>
    <vectorSlice idref="vectorSlice2">
  </hypermutationRate>
  <hypermutationIndicators>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView5">
  </hypermutationIndicators>
</hypermutantErrorModel>

<immutableParameter> element

An immutable parameter generated from a statistic.

The element has the following contents:

Example:

<immutableParameter>
  <matrixInverse>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView6">
  </matrixInverse>
</immutableParameter>

<ImportanceNarrowExchange> element

This element represents a swap operator. This operator swaps a random subtree with its uncle.

The element takes following attributes:

  • weight is of type Double
  • epsilon (optional) is of type Double

The element has the following contents:

Example:

<ImportanceNarrowExchange weight="1.0" epsilon="1.0">
  <sequenceSimulator replications="1">
    <tree idref="tree8">
    ERROR!
  </sequenceSimulator>
  <treeModel fixHeights="true" fixTree="true">
    <upgmaTree idref="upgmaTree8">
    <rootHeight>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </nodeHeights>
    <leafHeight taxon="foo">
      <diagonalMatrix idref="diagonalMatrix4">
    </leafHeight>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser1">
    </leafHeight>
    <leafHeight taxon="foo">
      <complementParameter idref="complementParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <immutableParameter idref="immutableParameter5">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastMatrixParameter idref="fastMatrixParameter7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <fastMatrixParameter idref="fastMatrixParameter5">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter10">
    </leafTrait>
  </treeModel>
</ImportanceNarrowExchange>

<ImportancePruneAndRegraft> element

This element represents a importance guided prune and regraft operator. This operator prunes a random subtree and regrafts it below a node chosen by an importance distribution.

The element takes following attributes:

The element has the following contents:

Example:

<ImportancePruneAndRegraft weight="1.0" samples="1">
  <starTreeModel>
    <tree idref="tree4">
    <rootHeight>
      <matrixMatrixProduct idref="matrixMatrixProduct4">
    </rootHeight>
    <leafTrait taxon="foo" name="foo">
      <jointParameter idref="jointParameter10">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <matrixMatrixProduct idref="matrixMatrixProduct2">
    </leafTrait>
  </starTreeModel>
</ImportancePruneAndRegraft>

<ImportanceSubtreeSwap> element

This element represents a importance guided subtree swap operator. This operator swaps a random subtree with a second subtree guided by an importance distribution.

The element takes following attributes:

The element has the following contents:

Example:

<ImportanceSubtreeSwap weight="1.0" samples="1">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <upgmaTree idref="upgmaTree8">
  </empiricalTreeDistributionModel>
</ImportanceSubtreeSwap>

<individual> element

Individual specimen from a species, possibly containing multiple genomes.

The element has the following contents:

  • Taxon elements (one or more)

Example:

<individual>
  <individual>
    <individual idref="individual6">
    <individual idref="individual5">
    <sp idref="sp9">
  </individual>
  <taxon id="foo"/>
  <sp>
    <apsp idref="apsp2">
    <individual idref="individual1">
    <sp idref="sp10">
  </sp>
  <taxon id="foo"/>
</individual>

<individualPrior> element

Calculates the probability of a set of doubles all being drawn from the specified prior distribution

The element takes following attributes:

The element has the following contents:

Example:

<individualPrior id="foo">
  <distribution>
    <exponentialDistributionModel idref="exponentialDistributionModel7">
  </distribution>
</individualPrior>

<infectionBranchMovementOperator> element

This operator switches the painting of a random eligible internal node from the painting of one of its children to the painting of the other

The element takes following attributes:

  • weight is of type Double
  • resampleInfectionTimes (optional) is of type Boolean

The element has the following contents:

Example:

<infectionBranchMovementOperator weight="1.0" resampleInfectionTimes="true">
  <withinCaseCoalescent truncate="true">
    <partitionedTreeModel idref="partitionedTreeModel2">
    <maxFirstInfToRoot>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix4">
    </maxFirstInfToRoot>
    <demographicModel>
      <exponentialSawtooth idref="exponentialSawtooth4">
    </demographicModel>
  </withinCaseCoalescent>
</infectionBranchMovementOperator>

<inhibitionLikelihood> element

Provides the likelihood of a continuous trait evolving on a tree by a given diffusion model.

The element has the following contents:

Example:

<inhibitionLikelihood>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <distanceMatrix idref="distanceMatrix5">
  </empiricalTreeDistributionModel>
  <mvPolyaLikelihood>
    <data>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </data>
    <alpha>
      <duplicatedParameter idref="duplicatedParameter6">
    </alpha>
  </mvPolyaLikelihood>
  <precision>
    <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision5">
  </precision>
</inhibitionLikelihood>

<integer> element

returns an Integer. If a prompt attribute exists then the user is prompted for input, otherwise the character contents of the element are returned as an Integer.

The element has the following contents:

  • One of:
    • prompt is of type String
      “A message displayed to the user when entering a value for this integer”
    • Integer element (exactly one)

Example:

<integer prompt="Enter the number of categories:"/>

<integerParameter> element

An integer-valued parameter only for staircase bound.

The element takes following attributes:

  • value (optional) is of type Integer;
  • dimension (optional) is of type Integer

Example:

<integerParameter value="1 2 4 8" dimension="1"/>

<integratedFactorModel> element

null

The element takes following attributes:

  • traitName is of type String
  • nugget (optional) is of type Double

The element has the following contents:

Example:

<integratedFactorModel traitName="foo" nugget="1.0">
  <loadings>
    <matrixParameter idref="matrixParameter6">
  </loadings>
  <precision>
    <jointParameter idref="jointParameter8">
  </precision>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <speciesTree idref="speciesTree2">
    <rootHeight>
      <designMatrix idref="designMatrix4">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalMatrix idref="diagonalMatrix8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <compoundParameter idref="compoundParameter6">
    </nodeHeights>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <diagonalMatrix idref="diagonalMatrix5">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <vectorSlice idref="vectorSlice7">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <jointParameter idref="jointParameter1">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter5">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak10">
    </outbreak>
  </partitionedTreeModel>
  <traitParameter>
    <leafTraitParameter idref="leafTraitParameter9">
  </traitParameter>
</integratedFactorModel>

<integratedMixtureModel> element

This element represents a finite mixture of likelihood models.

The element takes following attributes:

  • normalize (optional) is of type Boolean

The element has the following contents:

Example:

<integratedMixtureModel normalize="true">
  <mulSpeciesTreePrior>
    <model>
      <birthDeathSerialSampling idref="birthDeathSerialSampling7">
    </model>
    <mulTree>
      <mulSpeciesTree idref="mulSpeciesTree2">
    </mulTree>
  </mulSpeciesTreePrior>
  <compoundLikelihood threads="1"/>
  <buildCompoundSymmetricMatrix/>
</integratedMixtureModel>

<traitGibbsOperator> element

This element returns a multivariate Gibbs operator on traits for possible all nodes.

The element takes following attributes:

  • weight is of type Double
  • onlyInternalNodes (optional) is of type Boolean
  • onlyTipsWithPriors (optional) is of type Boolean

The element has the following contents:

Example:

<traitGibbsOperator weight="1.0" onlyInternalNodes="true" onlyTipsWithPriors="true">
  ERROR!
  <multivariateGammaPrior>
    <meanParameter>
      <vectorSlice idref="vectorSlice10">
    </meanParameter>
    <scaleParameter>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix8">
    </scaleParameter>
    <data>
      <duplicatedParameter idref="duplicatedParameter6">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter10">
    </data>
  </multivariateGammaPrior>
  <treeTraitNormalDistributionLikelihood>
    <treeTraitNormalDistribution idref="treeTraitNormalDistribution3">
    <data>
      <parameter idref="parameter9">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
    </data>
  </treeTraitNormalDistributionLikelihood>
</traitGibbsOperator>

<intervalLatentLiabilityLikelihood> element

Provides the likelihood of a latent liability model on multivariate-binary trait data

The element has the following contents:

Example:

<intervalLatentLiabilityLikelihood>
  <inhibitionLikelihood>
    <partitionedTreeModel idref="partitionedTreeModel4">
    <dataFromTreeTips idref="dataFromTreeTips9">
    <precision>
      <designMatrix idref="designMatrix4">
    </precision>
  </inhibitionLikelihood>
  <tipTrait>
    <compoundMatrixParameter idref="compoundMatrixParameter3">
  </tipTrait>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <neighborJoiningTree idref="neighborJoiningTree9">
  </empiricalTreeDistributionModel>
</intervalLatentLiabilityLikelihood>

<invariantOperator> element

This element returns a operator that forces the entire model likelihood recomputation

The element takes following attributes:

  • weight is of type Double
  • translate (optional) is of type Boolean
  • rotate (optional) is of type Boolean
  • checkLikelihood (optional) is of type Boolean

The element has the following contents:

Example:

<invariantOperator weight="1.0" translate="true" rotate="true" checkLikelihood="true">
  <differenceParameter>
    <diagonalMatrix idref="diagonalMatrix4">
    <productParameter idref="productParameter8">
  </differenceParameter>
</invariantOperator>

<inverseGammaDistributionModel> element

A model of an inverese gamma distribution.

The element has the following contents:

  • One of:
    • Element named <shape>

      Containing:

      • Double element (exactly one)
    • Element named <shape>

      Containing:

  • One of:
    • Element named <scale>

      Containing:

      • Double element (exactly one)
    • Element named <scale>

      Containing:

Example:

<inverseGammaDistributionModel>
  <shape>
    1.0
  </shape>
  <scale>
    1.0
  </scale>
</inverseGammaDistributionModel>

<invgammaPrior> element

Calculates the prior probability of some data under a given inverse gamma distribution.

The element takes following attributes:

The element has the following contents:

Example:

<invgammaPrior shape="1.0" scale="1.0" offset="1.0">
  <exponentialStatistic>
    <exponentialStatistic idref="exponentialStatistic1">
  </exponentialStatistic>
  <notStatistic>
    <sumParameter idref="sumParameter9">
  </notStatistic>
  <generalizedSkylinePopSizeStatistic/>
</invgammaPrior>

<inverseGaussianDistributionModel> element

Describes a inverse gaussian distribution with a given mean and shape (or standard deviation) that can be used in a distributionLikelihood element

The element takes following attributes:

  • offset (optional) is of type Double

The element has the following contents:

  • Element named <mean>

    Containing:

  • Element named <stdev>

    Containing:

  • Element named <shape>

    Containing:

Example:

<inverseGaussianDistributionModel offset="1.0">
  <mean>
    1.0
  </mean>
</inverseGaussianDistributionModel>

<inverseTransform> element

null

The element has the following contents:

Example:

<inverseTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform9">
    </outer>
    <inner>
      <transform idref="transform7">
    </inner>
  </composedTransform>
</inverseTransform>

<invgammaPrior> element

Calculates the prior probability of some data under a given inverse gamma distribution.

The element takes following attributes:

The element has the following contents:

Example:

<invgammaPrior shape="1.0" scale="1.0" offset="1.0">
  <coalescentIntervalStatistic>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood2">
  </coalescentIntervalStatistic>
  <adaptableSizeFastMatrixParameter columns="1" rows="1" maxRowSize="1" maxColumnSize="1" startingValue="1.0" lowerTriangle="true"/>
  <sumParameter>
    <vectorSlice idref="vectorSlice4">
    <matrixParameter idref="matrixParameter1">
  </sumParameter>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <maskedMatrixParameter idref="maskedMatrixParameter10">
  </maskedMatrixParameter>
</invgammaPrior>

<oneOnXPrior> element

Calculates the (improper) prior proportional to Prod_i (1/x_i) for the given statistic x.

The element has the following contents:

  • One of:
    • Statistic elements (one or more)

    • Element named <data>

      Containing:

Example:

<oneOnXPrior>
  <continuousDiffusionStatistic name="foo" greatCircleDistance="true" mode="foo" statistic="foo" discreteState="foo" heightUpper="1.0" heightLower="1.0" heightLowerSerie="foo" dimension="1.0" cumulative="true" noise="true" branchSet="foo">
    <inhibitionLikelihood idref="inhibitionLikelihood6">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood7">
  </continuousDiffusionStatistic>
</oneOnXPrior>

<jitter> element

This element returns a random walk operator on a given parameter.

The element takes following attributes:

  • times (optional) is of type Integer
  • scale (optional) is of type Double

The element has the following contents:

Example:

<jitter times="1" scale="1.0">
  <leafTraitParameter taxon="foo" setBounds="true">
    <treeModel idref="treeModel4">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </leafTraitParameter>
</jitter>

<sumDerivative> element

null

The element has the following contents:

Example:

<sumDerivative>
  <gradient>
    <cachedPrior idref="cachedPrior7">
  </gradient>
  <sumDerivative>
    <sumDerivative idref="sumDerivative7">
  </sumDerivative>
</sumDerivative>

<jointOperator> element

This element represents an arbitrary list of operators; only the first is optimizable

The element takes following attributes:

  • weight is of type Double
  • targetAcceptance (optional) is of type Double

The element has the following contents:

Example:

<jointOperator weight="1.0" targetAcceptance="1.0">
  <MsatFullAncestryImportanceSamplingOperator weight="1.0">
    <leafTraitParameter idref="leafTraitParameter1">
    <microsatelliteSamplerTreeModel idref="microsatelliteSamplerTreeModel5">
    ERROR!
    <argDiscretizedBranchRates idref="argDiscretizedBranchRates9">
  </MsatFullAncestryImportanceSamplingOperator>
  <transmissionExchangeOperatorA weight="1.0" resampleInfectionTimes="true">
    <withinCaseCoalescent idref="withinCaseCoalescent2">
  </transmissionExchangeOperatorA>
  <narrowExchange weight="1.0">
    <treeModel idref="treeModel7">
  </narrowExchange>
  <setOperator set="0.5 1.0" weight="1.0">
    <productParameter idref="productParameter10">
  </setOperator>
</jointOperator>

<jointParameter> element

A parameter that synchronises its component parameters.

The element has the following contents:

Example:

<jointParameter>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix3">
  </maskedMatrixParameter>
  <matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix3">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    <differenceMatrixParameter idref="differenceMatrixParameter1">
  </matrixParameter>
</jointParameter>

<knownVarianceNormalPeriodPriorDistribution> element

Calculates the probability of a set of doubles being drawn from the prior posterior distributionof a normal distribution of unknown mean and known standard deviation sigma

The element takes following attributes:

Example:

<knownVarianceNormalPeriodPriorDistribution log="true" id="foo" mu0="1.0" sigma="1.0" sigma0="1.0"/>

<kStateType> element

Parser for k-state model.

The element takes following attributes:

  • stateCount is of type Integer
  • startWith (optional) is of type Integer

Example:

<kStateType stateCount="1" startWith="1"/>

<laplacePrior> element

Calculates the prior probability of some data under a given laplace distribution.

The element takes following attributes:

The element has the following contents:

Example:

<laplacePrior mean="1.0" scale="1.0">
  <parsimonyStatistic name="foo">
    <partitionedTreeModel idref="partitionedTreeModel5">
    <state>
      <taxa idref="taxa3">
    </state>
  </parsimonyStatistic>
  <differenceStatistic absolute="true">
    <alloppNumHybsStatistic idref="alloppNumHybsStatistic2">
    <mvPolyaLikelihood idref="mvPolyaLikelihood1">
  </differenceStatistic>
  <maskedMatrixParameter complement="true" from="1" to="1" every="1">
    <dataFromTreeTips idref="dataFromTreeTips5">
  </maskedMatrixParameter>
</laplacePrior>

<latentFactorModel> element

Sets up a latent factor model, with starting guesses for the loadings and factor matrices as well as the data for the factor analysis

The element takes following attributes:

  • factorNumber is of type Integer
  • scaleData (optional) is of type Boolean
  • computeResidualsForDiscrete (optional) is of type Boolean
  • recomputeFactors (optional) is of type Boolean
  • recomputeResiduals (optional) is of type Boolean
  • recomputeLoadings (optional) is of type Boolean

The element has the following contents:

Example:

<latentFactorModel factorNumber="1" scaleData="true" computeResidualsForDiscrete="true" recomputeFactors="true" recomputeResiduals="true" recomputeLoadings="true">
  <data>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter6">
  </data>
  <factors>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </factors>
  <loadings>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter2">
  </loadings>
  <rowPrecision>
    ERROR!
  </rowPrecision>
  <columnPrecision>
    ERROR!
  </columnPrecision>
</latentFactorModel>

<latentLiabilityGibbsOperator> element

This element returns a gibbs sampler on tip latent trais for latent liability model.

The element takes following attributes:

The element has the following contents:

Example:

<latentLiabilityGibbsOperator weight="1.0">
  ERROR!
  <latentLiabilityLikelihood>
    <inhibitionLikelihood idref="inhibitionLikelihood4">
    <tipTrait>
      <dataFromTreeTips idref="dataFromTreeTips8">
    </tipTrait>
    <maskedPatterns idref="maskedPatterns5">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
  </latentLiabilityLikelihood>
  <originDestinationDesignMatrix latitudeTrait="foo" longitudeTrait="foo">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix6">
    <generalDataType idref="generalDataType6">
  </originDestinationDesignMatrix>
</latentLiabilityGibbsOperator>

<latentLiabilityLikelihood> element

Provides the likelihood of a latent liability model on multivariate-binary trait data

The element has the following contents:

Example:

<latentLiabilityLikelihood>
  <inhibitionLikelihood>
    <starTreeModel idref="starTreeModel8">
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix9">
    <precision>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
    </precision>
  </inhibitionLikelihood>
  <tipTrait>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix2">
  </tipTrait>
  <constantPatterns>
    <patternSubSet idref="patternSubSet10">
    <counts>
      <matrixMatrixProduct idref="matrixMatrixProduct9">
    </counts>
  </constantPatterns>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <upgmaTree idref="upgmaTree2">
    <rootHeight>
      <matrixVectorProductParameter idref="matrixVectorProductParameter6">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice10">
    </nodeHeights>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter5">
    </leafHeight>
    <leafHeight taxon="foo">
      <diagonalMatrix idref="diagonalMatrix7">
    </leafHeight>
    <leafHeight taxon="foo">
      <immutableParameter idref="immutableParameter9">
    </leafHeight>
    <leafHeight taxon="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix3">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <jointParameter idref="jointParameter6">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter7">
    </nodeRates>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak10">
    </outbreak>
  </partitionedTreeModel>
</latentLiabilityLikelihood>

<latentStateBranchRateModel> element

This element provides a model with a latent state where no evolution occurs but condition on being non-latent at the nodes.

The element has the following contents:

  • BranchRateModel element (exactly one)
    A branch rate model to provide the rates for the non-latent state
  • TreeModel element (exactly one)
    The tree on which this will operate
  • CountableBranchCategoryProvider element (zero or one)

  • Element named <latentTransitionRate>
    A parameter which gives the instantaneous rate of switching to and from the latent state

    Containing:

  • Element named <latentTransitionFrequency>
    A parameter which gives the rate bias of switching to and from the latent state

    Containing:

  • Element named <latentStateProportions>
    The proportion of each branch which is spend in a latent state

    Containing:

Example:

<latentStateBranchRateModel>
  <continuousBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0">
    <treeModel idref="treeModel2">
    <distribution>
      <poissonDistributionModel idref="poissonDistributionModel9">
    </distribution>
    <rateCategoryQuantiles>
      <matrixParameter idref="matrixParameter6">
    </rateCategoryQuantiles>
  </continuousBranchRates>
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork1">
    <rootHeight>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <vectorSlice idref="vectorSlice9">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter10">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <fastMatrixParameter idref="fastMatrixParameter3">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
    </nodeHeights>
    <leafHeight taxon="foo">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </leafHeight>
    <leafHeight taxon="foo">
      <complementParameter idref="complementParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <parameter idref="parameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter10">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter7">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedMatrixParameter idref="maskedMatrixParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <leafTraitParameter idref="leafTraitParameter4">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter10">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix7">
    </leafTrait>
  </treeModel>
  <latentTransitionRate>
    <dataFromTreeTips idref="dataFromTreeTips10">
  </latentTransitionRate>
  <latentTransitionFrequency>
    <differenceParameter idref="differenceParameter2">
  </latentTransitionFrequency>
</latentStateBranchRateModel>

<leafTraitParameter> element

Parses the leaf trait parameter out of the compound parameter of an integrated trait likelihood

The element takes following attributes:

  • taxon is of type String
  • setBounds (optional) is of type Boolean

The element has the following contents:

Example:

<leafTraitParameter taxon="foo" setBounds="true">
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <partitionedTreeModel idref="partitionedTreeModel3">
    <rootHeight>
      <matrixParameter idref="matrixParameter10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <dataFromTreeTips idref="dataFromTreeTips2">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <copyParameterValues idref="copyParameterValues6">
    </nodeHeights>
    <leafHeight taxon="foo">
      <matrixMatrixProduct idref="matrixMatrixProduct6">
    </leafHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix10">
    </leafHeight>
    <leafHeight taxon="foo">
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </leafHeight>
    <leafHeight taxon="foo">
      <maskedMatrixParameter idref="maskedMatrixParameter1">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <copyParameterValues idref="copyParameterValues4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <complementParameter idref="complementParameter6">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true">
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter3">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <vectorSlice idref="vectorSlice3">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <sumParameter idref="sumParameter5">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <complementParameter idref="complementParameter3">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak6">
    </outbreak>
  </partitionedTreeModel>
  <elementWiseMatrixMultiplicationParameter/>
</leafTraitParameter>

<lewisMk> element

A parser for Lewis’s Mk model

The element takes following attributes:

  • totalOrder (optional) is of type Boolean

The element has the following contents:

  • Element named <frequencies>

    Containing:

  • Element named <order>

    Containing:

Example:

<lewisMk totalOrder="true">
  <frequencies>
    <frequencyModel idref="frequencyModel5">
  </frequencies>
  <order state="foo" adjacentTo="foo"/>
  <order state="foo" adjacentTo="foo"/>
  <order state="foo" adjacentTo="foo"/>
  <order state="foo" adjacentTo="foo"/>
</lewisMk>

<compoundLikelihood> element

A likelihood function which is simply the product of its component likelihood functions.

The element takes following attributes:

  • threads (optional) is of type Integer

The element has the following contents:

Example:

<compoundLikelihood threads="1">
  <modelSpecificPseudoPrior/>
  <pathLikelihood>
    <source>
      <modelSpecificPseudoPrior idref="modelSpecificPseudoPrior3">
    </source>
    <destination>
      <multivariateInverseWishartPrior idref="multivariateInverseWishartPrior2">
    </destination>
  </pathLikelihood>
  <logTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
    <treeLengthStatistic idref="treeLengthStatistic8">
    <sumParameter idref="sumParameter6">
    <copyParameterValues idref="copyParameterValues2">
  </logTransformedNormalReferencePrior>
  <compoundLikelihood threads="1">
    <twoPartDistribution idref="twoPartDistribution4">
  </compoundLikelihood>
</compoundLikelihood>

<likelihoodProfile> element

This element represents a tool to profile a likelihood surface

The element takes following attributes:

The element has the following contents:

Example:

<likelihoodProfile lower="0.5 1.0" upper="0.5 1.0" dim="1" points="1">
  <uniformNodeHeightPrior analytic="true" maxRootHeight="1.0" mcSampleSize="1" marginal="true" approximate="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel4">
  </uniformNodeHeightPrior>
  <differenceMatrixParameter/>
</likelihoodProfile>

<lineageCountStatistic> element

The element has the following contents:

Example:

<lineageCountStatistic>
  <generalizedSkyLineLikelihood linear="true">
    <populationSizes>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix8">
    </populationSizes>
    <groupSizes>
      <matrixParameter idref="matrixParameter5">
    </groupSizes>
    <populationTree>
      <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel6">
    </populationTree>
  </generalizedSkyLineLikelihood>
</lineageCountStatistic>

<lineageSpecificBranchModel> element

This element provides a branch model which has branches assigned to specific substitution models.These assignments can then be changed in course of MCMC.

The element has the following contents:

Example:

<lineageSpecificBranchModel>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <alignment idref="alignment9">
  </empiricalTreeDistributionModel>
  <frequencyModel composition="3x4" normalize="true" compress="true" dataType="codon-universal">
    <frequencies>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
    </frequencies>
  </frequencyModel>
  <models>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood6">
    <uniformNodeHeightPrior idref="uniformNodeHeightPrior2">
  </models>
  <categories>
    <compoundFastMatrixParameter idref="compoundFastMatrixParameter9">
  </categories>
</lineageSpecificBranchModel>

<localClockModel> element

This element returns a branch rate model that adds a delta to each terminal branch length.

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <rate>
    The molecular evolutionary rate parameter

    Containing:

  • Element named <externalBranches>

    Containing:

    • relative (optional) is of type Boolean
    • Taxa element (exactly one)
      A local clock that will be applied only to the external branches for these taxa
    • Parameter element (exactly one)
      The rate parameter
  • Element named <clade>

    Containing:

    • relative (optional) is of type Boolean
    • includeStem (optional) is of type Boolean
      “determines whether or not the stem branch above this clade is included in the siteModel (default false).”
    • stemProportion (optional) is of type Double
      “proportion of stem to include in clade rate (default 0).”
    • excludeClade (optional) is of type Boolean
      “determines whether to exclude actual branches of the clade from the siteModel (default false).”
    • Taxa element (exactly one)
      A set of taxa which defines a clade to apply a different site model to
    • Parameter element (exactly one)
      The rate parameter
  • Element named <trunk>

    Containing:

    • relative (optional) is of type Boolean
    • Taxa element (exactly one)
      A local clock that will be applied only to the ‘trunk’ branches defined by these taxa
    • Parameter element (exactly one)
      The rate parameter
    • Element named <index>
      The trunk taxon index

      Containing:

Example:

<localClockModel>
  <starTreeModel>
    <treeModel idref="treeModel10">
    <rootHeight>
      <fastMatrixParameter idref="fastMatrixParameter7">
    </rootHeight>
    <leafHeight taxon="foo">
      <maskedParameter idref="maskedParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter9">
    </leafHeight>
    <leafTrait taxon="foo" name="foo">
      <parameter idref="parameter6">
    </leafTrait>
  </starTreeModel>
  <rate>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
  </rate>
  <clade relative="true" includeStem="true" stemProportion="1.0" excludeClade="true">
    <taxa idref="taxa3">
    <dataFromTreeTips idref="dataFromTreeTips4">
  </clade>
  <trunk relative="true">
    <taxa idref="taxa1">
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter8">
  </trunk>
  <trunk relative="true">
    <taxa idref="taxa6">
    <differenceMatrixParameter idref="differenceMatrixParameter5">
  </trunk>
</localClockModel>

<location> element

Specifies a location with an optional longitude and latitude

The element takes following attributes:

  • description (optional) is of type String
    “A description of this location”
  • longitude (optional) is of type String
    “The longitude in degrees, minutes, seconds or decimal degrees”
  • latitude (optional) is of type String
    “The latitude in degrees, minutes, seconds or decimal degrees”

Example:

<location description="foo" longitude="foo" latitude="foo"/>

<log> element

Logs one or more items at a given frequency to the screen or to a file

The element takes following attributes:

  • logEvery is of type Integer
  • overwrite (optional) is of type Boolean
  • fileName (optional) is of type String
    “The name of the file to send log output to. If no file name is specified then log is sent to standard output”
  • title (optional) is of type String
    “The title of the log”
  • header (optional) is of type String
    “The subtitle of the log”

The element has the following contents:

  • At least one of:

Example:

<log logEvery="1" overwrite="true" fileName="foo" title="foo" header="foo">
  <biasedMultivariateDiffusionModel>
    <precisionMatrix>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter4">
    </precisionMatrix>
    <biasParameter>
      <designMatrix idref="designMatrix9">
    </biasParameter>
  </biasedMultivariateDiffusionModel>
  <gmrfBivariateCurveAnalysis fileName1="foo" fileName2="foo" endTime="foo" burnIn="1"/>
  <uniformPartitionLikelihood>
    <argTreeModel idref="argTreeModel6">
  </uniformPartitionLikelihood>
</log>

<logAllTraits> element

null

The element has the following contents:

  • TreeModel element (exactly one)
    The tree which is to be logged

Example:

<logAllTraits>
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <alignment idref="alignment4">
  </empiricalTreeDistributionModel>
</logAllTraits>

<logArg> element

Logs an ARG to a file

The element takes following attributes:

  • logEvery is of type Integer
  • format is of type String
    “The type logger’s output type”
  • fileName (optional) is of type String
    “The name of the file to send log output to. If no file name is specified then log is sent to standard output”
  • title (optional) is of type String
    “The title of the log”

The element has the following contents:

  • ARGModel element (exactly one)
    The ARG which is to be logged

Example:

<!-- The logArg element takes an argModel to be logged -->
<logArg logEvery="100" fileName="log.args">
	<argModel idref="treeModel1"/>
</logArg>

<logArgTree> element

Logs a tree to a file

The element takes following attributes:

  • logEvery is of type Integer
  • partition is of type Integer
  • fileName (optional) is of type String
    “The name of the file to send log output to. If no file name is specified then log is sent to standard output”
  • title (optional) is of type String
    “The title of the log”
  • nexusFormat (optional) is of type Boolean
    “Whether to use the NEXUS format for the tree log”
  • branchLengths (optional) is of type String
    “What units should the branch lengths be in”

The element has the following contents:

Example:

<!-- The logArgTree element takes an argTreeModel to be logged -->
<logArgTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logArgTree>

<logarithmStatistic> element

This element returns a statistic that is the element-wise natural logarithm of the child statistic.

The element takes following attributes:

  • base (optional) is of type Double
    “An optional base for the logarithm (default is the natural logarithm, base e)”

The element has the following contents:

Example:

<logarithmStatistic base="1.0">
  <meanStatistic>
    <varianceStatistic idref="varianceStatistic9">
    <popGraph idref="popGraph8">
    <coalescentEventsStatistic idref="coalescentEventsStatistic7">
  </meanStatistic>
</logarithmStatistic>

<logarithmStatistic> element

This element returns a statistic that is the element-wise natural logarithm of the child statistic.

The element takes following attributes:

  • base (optional) is of type Double
    “An optional base for the logarithm (default is the natural logarithm, base e)”

The element has the following contents:

Example:

<logarithmStatistic base="1.0">
  <productParameter>
    <jointParameter idref="jointParameter5">
    <productParameter idref="productParameter6">
  </productParameter>
</logarithmStatistic>

<logFileTrace> element

reconstruct population graph from variable dimension run.

The element takes following attributes:

  • fileName is of type String
    “trace log.”
  • burnIn (optional) is of type Integer
    “The number of states (not sampled states, but actual states) that are discarded from the beginning of the trace before doing the analysis”

Example:

<logFileTrace fileName="foo" burnIn="1"/>

<loggableStatistic> element

Allows you to choose specific dimensions of a given statistic

The element has the following contents:

Example:

<loggableStatistic>
  <jointParameter>
    <sumParameter idref="sumParameter10">
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix4">
    <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix5">
    <duplicatedParameter idref="duplicatedParameter9">
  </jointParameter>
</loggableStatistic>

<logisticGrowth> element

Logistic growth demographic model.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>
    This parameter represents the population size at time 0 (the time of the last tip of the tree)

    Containing:

  • One of:
    • Element named <growthRate>
      This parameter determines the rate of growth during the exponential phase. See exponentialGrowth for details.

      Containing:

    • Element named <doublingTime>
      This parameter determines the doubling time at peak growth rate.

      Containing:

  • Element named <t50>
    This parameter represents the time in the past when the population was half of that which it isat time zero (not half it’s carrying capacity). It is therefore a positive number with the same units as divergence times. A scale operator is recommended with a starting value near zero. A lower bound of zero should be employed and an upper bound is recommended.

    Containing:

Example:

<logisticGrowth units="mutations">
  <populationSize>
    <fastMatrixParameter idref="fastMatrixParameter8">
  </populationSize>
  <growthRate>
    <markovRandomFieldMatrix idref="markovRandomFieldMatrix4">
  </growthRate>
  <t50>
    <mvPolyaLikelihood idref="mvPolyaLikelihood10">
  </t50>
</logisticGrowth>

<logitTransformedNormalReferencePrior> element

Calculates the reference prior probability of some data under logit transformed normal distribution.

The element takes following attributes:

  • fileName is of type String
  • parameterColumn is of type String
  • burnin is of type Integer
  • dimension (optional) is of type Integer
  • upperLimit (optional) is of type Double

The element has the following contents:

Example:

<logitTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1" dimension="1" upperLimit="1.0">
  <partitionStatistic/>
</logitTransformedNormalReferencePrior>

<logitTransformedNormalReferencePrior> element

Calculates the reference prior probability of some data under logit transformed normal distribution.

The element takes following attributes:

  • fileName is of type String
  • parameterColumn is of type String
  • burnin is of type Integer
  • dimension (optional) is of type Integer
  • upperLimit (optional) is of type Double

The element has the following contents:

Example:

<logitTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1" dimension="1" upperLimit="1.0">
  <differenceStatistic absolute="true">
    <coalescentIntervalStatistic idref="coalescentIntervalStatistic3">
    <sumStatistic idref="sumStatistic8">
  </differenceStatistic>
  <logarithmStatistic base="1.0">
    <sumStatistic idref="sumStatistic3">
  </logarithmStatistic>
  <logarithmStatistic base="1.0">
    <treeMetricStatistic idref="treeMetricStatistic3">
  </logarithmStatistic>
  <lineageCountStatistic>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood5">
  </lineageCountStatistic>
</logitTransformedNormalReferencePrior>

<logML> element

Logs one or more items every time the given likelihood improves

The element takes following attributes:

  • logEvery (optional) is of type Integer

The element has the following contents:

  • Element named <ml>

    Containing:

  • At least one of:

Example:

<logML logEvery="1">
  <ml>
    <glmSubstitutionModel idref="glmSubstitutionModel10">
  </ml>
  <column label="foo" sf="1" dp="1" width="1" format="foo">
    <cNcSTodNdSPerSiteAnalysis idref="cNcSTodNdSPerSiteAnalysis10">
    <intervalLatentLiabilityLikelihood idref="intervalLatentLiabilityLikelihood6">
    <antigenicDriftPrior idref="antigenicDriftPrior6">
    <argRatePrior idref="argRatePrior4">
  </column>
  <column label="foo" sf="1" dp="1" width="1" format="foo">
    <operators idref="operators1">
    <complexSubstitutionModel idref="complexSubstitutionModel1">
    <cNcSTodNdSPerSiteAnalysis idref="cNcSTodNdSPerSiteAnalysis2">
  </column>
</logML>

<logNormalDistributionModel> element

Describes a normal distribution with a given mean and standard deviation that can be used in a distributionLikelihood element

The element takes following attributes:

  • meanInRealSpace (optional) is of type Boolean
  • stdevInRealSpace (optional) is of type Boolean
  • offset (optional) is of type Double

The element has the following contents:

  • Element named <mean>

    Containing:

  • One of:

    • Element named <stdev>

      Containing:

    • Element named <precision>

      Containing:

Example:

<logNormalDistributionModel meanInRealSpace="true" stdevInRealSpace="true" offset="1.0">
  <mean>
    1.0
  </mean>
  <precision>
    <maskedMatrixParameter idref="maskedMatrixParameter2">
  </precision>
</logNormalDistributionModel>

<logNormalPrior> element

Calculates the prior probability of some data under a given lognormal distribution.

The element takes following attributes:

  • mean is of type Double
  • stdev is of type Double
  • offset (optional) is of type Double
  • meanInRealSpace (optional) is of type Boolean

The element has the following contents:

Example:

<logNormalPrior mean="1.0" stdev="1.0" offset="1.0" meanInRealSpace="true">
  <compoundParameter>
    <leafTraitParameter idref="leafTraitParameter4">
    <differenceMatrixParameter idref="differenceMatrixParameter5">
    <immutableParameter idref="immutableParameter4">
    <sumParameter idref="sumParameter4">
  </compoundParameter>
  <externalLengthStatistic name="foo">
    <treeModel idref="treeModel2">
    <taxa idref="taxa1">
  </externalLengthStatistic>
  <statistic name="foo">
    <hkyModel idref="hkyModel5">
  </statistic>
</logNormalPrior>

<logPartitionedTree> element

Logs a partitioned tree (phylogenetic tree and transmission tree)

The element takes following attributes:

  • logEvery (optional) is of type Integer
  • overwrite (optional) is of type Boolean
  • fileName (optional) is of type String
    “The name of the file to send log output to. If no file name is specified then log is sent to standard output”
  • title (optional) is of type String
    “The title of the log”
  • nexusFormat (optional) is of type Boolean
    “Whether to use the NEXUS format for the tree log”
  • sortTranslationTable (optional) is of type Boolean
    “Whether the translation table is sorted.”
  • branchLengths (optional) is of type String
    “What units should the branch lengths be in”
  • traitFilter (optional) is of type String
  • mapNamesToNumbers (optional) is of type Boolean
  • dp (optional) is of type Integer

The element has the following contents:

Example:

<!-- The logPartitionedTree element takes a treeModel to be logged -->
<logPartitionedTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logPartitionedTree>

<logRandomWalkOperator> element

This element returns a scale operator on a given parameter.

The element takes following attributes:

  • window is of type Double
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • scaleAll (optional) is of type Boolean
  • scaleAllIndependently (optional) is of type Boolean

The element has the following contents:

Example:

<logRandomWalkOperator window="1.0" weight="1.0" autoOptimize="true" scaleAll="true" scaleAllIndependently="true">
  <fastMatrixParameter rows="1" columns="1"/>
</logRandomWalkOperator>

<logTransformedNormalReferencePrior> element

Calculates the reference prior probability of some data under log transformed normal distribution.

The element takes following attributes:

The element has the following contents:

Example:

<logTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <tmrcaStatistic name="foo" absolute="true" includeStem="true">
    <newick idref="newick2">
  </tmrcaStatistic>
  <test name="foo" greaterThan="1.0">
    <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser7">
  </test>
</logTransformedNormalReferencePrior>

<logTransformedNormalReferencePrior> element

Calculates the reference prior probability of some data under log transformed normal distribution.

The element takes following attributes:

The element has the following contents:

Example:

<logTransformedNormalReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
  <logarithmStatistic base="1.0">
    <differenceParameter idref="differenceParameter8">
  </logarithmStatistic>
  <lineageCountStatistic>
    <gmrfSkyrideLikelihood idref="gmrfSkyrideLikelihood8">
  </lineageCountStatistic>
  <nodeHeightsStatistic name="foo">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
  </nodeHeightsStatistic>
</logTransformedNormalReferencePrior>

<logTree> element

Logs a tree to a file

The element takes following attributes:

  • logEvery (optional) is of type Integer
  • overwrite (optional) is of type Boolean
  • fileName (optional) is of type String
    “The name of the file to send log output to. If no file name is specified then log is sent to standard output”
  • title (optional) is of type String
    “The title of the log”
  • nexusFormat (optional) is of type Boolean
    “Whether to use the NEXUS format for the tree log”
  • sortTranslationTable (optional) is of type Boolean
    “Whether the translation table is sorted.”
  • branchLengths (optional) is of type String
    “What units should the branch lengths be in”
  • traitFilter (optional) is of type String
  • mapNamesToNumbers (optional) is of type Boolean
  • dp (optional) is of type Integer

The element has the following contents:

Example:

<!-- The logTree element takes a treeModel to be logged -->
<logTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logTree>

<marginalLikelihoodAnalysis> element

Performs a trace analysis. Estimates the mean of the various statistics in the given log file.

The element takes following attributes:

  • fileName is of type String
    “The traceName of a BEAST log file (can not include trees, which should be logged separately”
  • burnIn (optional) is of type Integer

The element has the following contents:

  • Element named <likelihoodColumn>

    Containing:

    • name is of type String
      “The column name”

Example:

<marginalLikelihoodAnalysis fileName="foo" burnIn="1">
  <likelihoodColumn name="foo"/>
</marginalLikelihoodAnalysis>

<marginalLikelihoodEstimator> element

This element returns an MCMC chain and runs the chain as a side effect.

The element takes following attributes:

  • chainLength is of type Integer
  • pathSteps (optional) is of type Integer
  • burnin (optional) is of type Integer
  • prerun (optional) is of type Integer
  • linear (optional) is of type Boolean
  • lacing (optional) is of type Boolean
  • spawn (optional) is of type Boolean
  • printOperatorAnalysis (optional) is of type Boolean
  • pathScheme (optional) is of type String
  • fixedValues (optional) is of type Double;
  • alpha (optional) is of type Double
  • beta (optional) is of type Double

The element has the following contents:

  • Element named <samplers>

    Containing:

    • MCMC elements (one or more)
  • PathLikelihood element (exactly one)

  • MCLogger elements (one or more)

Example:

<marginalLikelihoodEstimator chainLength="1" pathSteps="1" burnin="1" prerun="1" linear="true" lacing="true" spawn="true" printOperatorAnalysis="true" pathScheme="foo" fixedValues="0.5 1.0" alpha="1.0" beta="1.0">
  <samplers>
    <mcmc idref="mcmc2">
  </samplers>
  ERROR!
  <logPartitionedTree logEvery="1" overwrite="true" fileName="foo" title="foo" nexusFormat="true" sortTranslationTable="true" branchLengths="time" traitFilter="foo" mapNamesToNumbers="true" dp="1">
    <speciesTree idref="speciesTree3">
    <trait name="foo" tag="foo">
      <biasedMultivariateDiffusionModel idref="biasedMultivariateDiffusionModel5">
    </trait>
    <trait name="foo" tag="foo">
      <bifractionalDiffusionModel idref="bifractionalDiffusionModel9">
    </trait>
    <productStatistic idref="productStatistic1">
    <transmissionLikelihood idref="transmissionLikelihood5">
    <matrixMatrixProduct idref="matrixMatrixProduct1">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood6">
    <speciesTree idref="speciesTree9">
    <withinCaseCoalescent idref="withinCaseCoalescent4">
  </logPartitionedTree>
</marginalLikelihoodEstimator>

<markovJumpsTreeLikelihood> element

This element represents the likelihood of a patternlist on a tree given the site model.

The element takes following attributes:

  • useAmbiguities (optional) is of type Boolean
  • stateTagName (optional) is of type String
  • jumpTagName (optional) is of type String
  • scaleRewardsByTime (optional) is of type Boolean
  • useUniformization (optional) is of type Boolean
  • reportUnconditionedValues (optional) is of type Boolean
  • numberOfSimulants (optional) is of type Integer
  • saveCompleteHistory (optional) is of type Boolean
  • logCompleteHistory (optional) is of type Boolean
  • compactHistory (optional) is of type Boolean
  • scalingScheme (optional) is of type String

The element has the following contents:

Example:

<markovJumpsTreeLikelihood useAmbiguities="true" stateTagName="foo" jumpTagName="foo" scaleRewardsByTime="true" useUniformization="true" reportUnconditionedValues="true" numberOfSimulants="1" saveCompleteHistory="true" logCompleteHistory="true" compactHistory="true" scalingScheme="foo">
  <constantPatterns>
    <constantPatterns idref="constantPatterns5">
    <counts>
      <copyParameterValues idref="copyParameterValues8">
    </counts>
  </constantPatterns>
  <treeModel fixHeights="true" fixTree="true">
    <alloppSpeciesNetwork idref="alloppSpeciesNetwork5">
    <rootHeight>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <designMatrix idref="designMatrix1">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <complementParameter idref="complementParameter4">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <jointParameter idref="jointParameter10">
    </nodeHeights>
    <leafHeight taxon="foo">
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter8">
    </leafHeight>
    <leafHeight taxon="foo">
      <leafTraitParameter idref="leafTraitParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix5">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <diagonalMatrix idref="diagonalMatrix4">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <differenceMatrixParameter idref="differenceMatrixParameter1">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <matrixParameter idref="matrixParameter5">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView1">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues10">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues5">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter4">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <dataFromTreeTips idref="dataFromTreeTips9">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <parameter idref="parameter2">
    </leafTrait>
  </treeModel>
  <siteModel>
    <mutationRate>
      <matrixVectorProductParameter idref="matrixVectorProductParameter1">
    </mutationRate>
  </siteModel>
  <blockUpperTriangularMatrixParameter transpose="true" columnDimension="1" diagonalRestriction="true"/>
</markovJumpsTreeLikelihood>

<markovModulatedSubstitutionModel> element

This element represents the a Markov-modulated substitution model.

The element takes following attributes:

  • dataType is of type String
  • geometricRates (optional) is of type Boolean
  • renormalize (optional) is of type Boolean

The element has the following contents:

Example:

<markovModulatedSubstitutionModel dataType="foo" geometricRates="true" renormalize="true">
  <switchingRates>
    <sumParameter idref="sumParameter7">
  </switchingRates>
  <lewisMk totalOrder="true">
    <frequencies>
      <frequencyModel idref="frequencyModel9">
    </frequencies>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
    <order state="foo" adjacentTo="foo"/>
  </lewisMk>
  <hkyModel>
    <frequencies>
      <frequencyModel idref="frequencyModel1">
    </frequencies>
    <kappa>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter8">
    </kappa>
  </hkyModel>
  <mutationDeathModel>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
    <extendedDataType idref="extendedDataType8">
  </mutationDeathModel>
  <mutationDeathModel>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
    <extendedDataType idref="extendedDataType6">
  </mutationDeathModel>
</markovModulatedSubstitutionModel>

<markovModulatedYangCodonModel> element

This element represents the a Markov-modulated Yang model of codon evolution.

The element takes following attributes:

  • dataType is of type String
  • geneticCode is of type String
  • diagonalization is of type String

The element has the following contents:

  • Element named <omega>

    Containing:

  • Element named <kappa>

    Containing:

  • Element named <switchingRates>

    Containing:

  • FrequencyModel element (exactly one)

Example:

<markovModulatedYangCodonModel dataType="foo" geneticCode="foo" diagonalization="foo">
  <omega>
    <compoundParameter idref="compoundParameter8">
  </omega>
  <kappa>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
  </kappa>
  <switchingRates>
    <dataFromTreeTips idref="dataFromTreeTips3">
  </switchingRates>
  <frequencyModel composition="3x4" normalize="true" compress="true">
    <extendedDataType idref="extendedDataType2">
    <frequencies>
      <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter7">
    </frequencies>
  </frequencyModel>
</markovModulatedYangCodonModel>

<markovRandomFieldMatrix> element

A MRF matrix parameter constructed from its diagonals and first-order off diagonal.

The element takes following attributes:

The element has the following contents:

Example:

<markovRandomFieldMatrix asCorrelation="true" dim="1">
  <diagonal>
    <maskedParameter idref="maskedParameter1">
  </diagonal>
  <offDiagonal>
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter8">
  </offDiagonal>
  <nugget>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter3">
  </nugget>
</markovRandomFieldMatrix>

<maskedGradient> element

null

The element has the following contents:

Example:

<maskedGradient>
  <appendedPotentialDerivative>
    <multiDimensionalScalingLikelihood idref="multiDimensionalScalingLikelihood5">
    <sumDerivative idref="sumDerivative5">
  </appendedPotentialDerivative>
  <mask>
    <duplicatedParameter idref="duplicatedParameter9">
  </mask>
</maskedGradient>

<maskedMatrixParameter> element

A masked matrix parameter.

The element takes following attributes:

  • complement (optional) is of type Boolean
  • from (optional) is of type Integer
  • to (optional) is of type Integer
  • every (optional) is of type Integer

The element has the following contents:

Example:

<maskedMatrixParameter complement="true" from="1" to="1" every="1">
  <markovRandomFieldMatrix asCorrelation="true" dim="1">
    <diagonal>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter6">
    </diagonal>
    <offDiagonal>
      <complementParameter idref="complementParameter3">
    </offDiagonal>
    <nugget>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix5">
    </nugget>
  </markovRandomFieldMatrix>
</maskedMatrixParameter>

<maskedParameter> element

A masked parameter.

The element takes following attributes:

  • complement (optional) is of type Boolean
  • build (optional) is of type Boolean
  • from (optional) is of type Integer
  • to (optional) is of type Integer
  • every (optional) is of type Integer

The element has the following contents:

  • Parameter element (exactly one)

  • Element named <mask>

    Containing:

Example:

<maskedParameter complement="true" build="true" from="1" to="1" every="1">
  <matrixMatrixProduct>
    <left>
      <diagonalMatrix idref="diagonalMatrix6">
    </left>
    <right>
      <matrixParameter idref="matrixParameter2">
    </right>
  </matrixMatrixProduct>
</maskedParameter>

<maskedPatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element takes following attributes:

  • negative (optional) is of type Boolean

The element has the following contents:

  • SiteList element (exactly one)

  • Element named <mask>
    A parameter of 1s and 0s that represent included and excluded sites

    Containing:

    • String element (exactly one)

Example:

<maskedPatterns negative="true">
  <hypermutantAlignment type="hA3F">
    <alignment idref="alignment10">
  </hypermutantAlignment>
  <mask>
    foo
  </mask>
</maskedPatterns>

<matrixInverse> element

This element returns a statistic that is the matrix inverse of the child statistic.

The element has the following contents:

Example:

<matrixInverse>
  <diagonalMatrix>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
  </diagonalMatrix>
</matrixInverse>

<matrixMatrixProduct> element

Gets Latent Factor Model to return data with residuals computed

The element has the following contents:

  • Element named <left>

    Containing:

  • Element named <right>

    Containing:

  • Element named <ColumnMask>
    Only some columns need to be multiplied

    Containing:

  • Element named <InPlace>
    Matrix values that are returned

    Containing:

Example:

<matrixMatrixProduct>
  <left>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix7">
  </left>
  <right>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter1">
  </right>
</matrixMatrixProduct>

<matrixParameter> element

A matrix parameter constructed from its component parameters.

The element takes following attributes:

  • rows (optional) is of type Integer
  • columns (optional) is of type Integer
  • transpose (optional) is of type Boolean
  • asCompoundParameter (optional) is of type Boolean
  • test (optional) is of type Boolean

The element has the following contents:

Example:

<matrixParameter rows="1" columns="1" transpose="true" asCompoundParameter="true" test="true">
  <approximateFactorAnalysisPrecision>
    <L>
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </L>
    <gamma>
      <maskedParameter idref="maskedParameter3">
    </gamma>
  </approximateFactorAnalysisPrecision>
  <fastBlockUpperTriangularMatrixParameterParser transpose="true" columns="1" rows="1"/>
</matrixParameter>

<matrixVectorProductParameter> element

A matrix-vector product of parameters.

The element has the following contents:

  • Element named <matrix>

    Containing:

  • Element named <vector>

    Containing:

Example:

<matrixVectorProductParameter>
  <matrix>
    <diagonalMatrix idref="diagonalMatrix4">
  </matrix>
  <vector>
    <productParameter idref="productParameter3">
  </vector>
</matrixVectorProductParameter>

<mcmc> element

This element returns an MCMC chain and runs the chain as a side effect.

The element takes following attributes:

  • chainLength is of type Long
  • autoOptimize (optional) is of type Boolean
  • autoOptimizeDelay (optional) is of type Integer
  • preBurnin (optional) is of type Integer
  • temperature (optional) is of type Double
  • fullEvaluation (optional) is of type Integer
  • minOpsFullEvaluations (optional) is of type Integer
  • evaluationThreshold (optional) is of type Double
  • spawn (optional) is of type Boolean
  • name (optional) is of type String
  • operatorAnalysis (optional) is of type String

The element has the following contents:

Example:

<mcmc chainLength="1" autoOptimize="true" autoOptimizeDelay="1" preBurnin="1" temperature="1.0" fullEvaluation="1" minOpsFullEvaluations="1" evaluationThreshold="1.0" spawn="true" name="foo" operatorAnalysis="foo">
  <operators sequential="true" optimizationSchedule="foo" minAcceptance="1.0" minUsage="1">
    <GibbsIndependentGammaOperator idref="GibbsIndependentGammaOperator4">
  </operators>
  <integratedFactorModel traitName="foo" nugget="1.0">
    <loadings>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision10">
    </loadings>
    <precision>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix9">
    </precision>
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel10">
    <traitParameter>
      <matrixVectorProductParameter idref="matrixVectorProductParameter2">
    </traitParameter>
  </integratedFactorModel>
  <logArg logEvery="1" format="extendedNewick" fileName="foo" title="foo">
    <argTreeModel idref="argTreeModel4">
  </logArg>
</mcmc>

<mdsModeFinder> element

Provides a mode finder for a MDS model on a tree

The element takes following attributes:

  • tolerance (optional) is of type Double

The element has the following contents:

Example:

<mdsModeFinder tolerance="1.0">
  <multiDimensionalScalingLikelihood fileName="foo" mdsDimension="1" useOld="true" includeTruncation="true" forceReorder="true">
    <locations>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser6">
    </locations>
    <mdsPrecision>
      <differenceMatrixParameter idref="differenceMatrixParameter4">
    </mdsPrecision>
  </multiDimensionalScalingLikelihood>
</mdsModeFinder>

<meanStatistic> element

This element returns a statistic that is the mean of the child statistics.

The element has the following contents:

Example:

<meanStatistic>
  <reciprocalStatistic>
    <productStatistic idref="productStatistic9">
  </reciprocalStatistic>
  <copyParameterValues>
    <source>
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter10">
    </source>
    <destination>
      <duplicatedParameter idref="duplicatedParameter4">
    </destination>
  </copyParameterValues>
  <mvPolyaLikelihood>
    <data>
      <compoundSymmetricMatrix idref="compoundSymmetricMatrix8">
    </data>
    <alpha>
      <markovRandomFieldMatrix idref="markovRandomFieldMatrix7">
    </alpha>
  </mvPolyaLikelihood>
  <rateCovarianceStatistic name="foo">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel1">
    <argDiscretizedBranchRates idref="argDiscretizedBranchRates8">
  </rateCovarianceStatistic>
</meanStatistic>

<mergePatterns> element

A weighted list of the unique site patterns (unique columns) in an alignment.

The element has the following contents:

Example:

<mergePatterns>
  <microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
    <taxa idref="taxa9">
    <microsatellite idref="microsatellite1">
    <microsatSeq>
        1,2,3,4,5,67,100
    </microsatSeq>
  </microsatellitePattern>
</mergePatterns>

<MetagenomeData> element

Data representing metagenome reads aligned to reference sequences and a reference tree

The element takes following attributes:

  • fixedReferenceTree (optional) is of type Boolean
    “Whether the reference tree should be of fixed topology”

The element has the following contents:

Example:

<MetagenomeData fixedReferenceTree="true">
  <taxa>
    <sp idref="sp9">
    <taxon idref="taxon1">
    <sp idref="sp6">
    <apsp idref="apsp3">
  </taxa>
  <hypermutantAlignment type="all">
    <convert idref="convert4">
  </hypermutantAlignment>
</MetagenomeData>

<microsatellite> element

This element represents a microsatellite data type.

The element has the following contents:

Example:

<microsatellite min="0" max="20" unitLength="2"/>```



### <code>&lt;microsatellitePattern&gt;</code> element

This element represents a microsatellite pattern.

The element takes following attributes:

* <code>id</code>  is of type [String](#string)
: "the name of the locus"

* <code>printDetails</code> (optional) is of type [Boolean](#boolean)
: 

* <code>printMsatPatContent</code> (optional) is of type [Boolean](#boolean)
: 

The element has the following contents:

* [Taxa](#taxa) element (exactly one)

* [Microsatellite](#microsatellite) element (exactly one)

* Element named <code>&lt;microsatSeq&gt;</code>

    Containing:

    * [String](#string) element (exactly one)
: A string of numbers representing the microsatellite lengths for a locus

Example:

```html
<microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
  <taxa>
    <individual idref="individual3">
    <sp idref="sp1">
    <sp idref="sp6">
  </taxa>
  <microsatellite/>
  <microsatSeq>
      1,2,3,4,5,67,100
  </microsatSeq>
</microsatellitePattern>

<microsatelliteSamplerTreeModel> element

This parser returns a TreeMicrosatelliteSamplerModel Object

The element takes following attributes:

  • provideInternalNodeValues (optional) is of type Boolean

The element has the following contents:

  • Element named <tree>

    Containing:

  • Element named <internalValues>

    Containing:

  • Element named <externalValues>

    Containing:

Example:

<microsatelliteSamplerTreeModel provideInternalNodeValues="true">
  <tree>
    <starTreeModel idref="starTreeModel4">
  </tree>
  <internalValues>
    <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter3">
  </internalValues>
  <externalValues>
    <microsatelliteSimulator idref="microsatelliteSimulator5">
  </externalValues>
</microsatelliteSamplerTreeModel>

<microsatelliteSimulator> element

This parser facilliates simulation of microsatellites given a tree and infinitesimal rate model

The element has the following contents:

Example:

<microsatelliteSimulator>
  <microsatellite/>
  <taxa>
    <individual idref="individual9">
    <individual idref="individual9">
    <sp idref="sp5">
  </taxa>
  <partitionedTreeModel startingTransmissionTreeFile="foo">
    <tree idref="tree1">
    <rootHeight>
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <matrixParameter idref="matrixParameter6">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <maskedMatrixParameter idref="maskedMatrixParameter8">
    </nodeHeights>
    <nodeHeights rootNode="true" internalNodes="true">
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </nodeHeights>
    <leafHeight taxon="foo">
      <immutableParameter idref="immutableParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <dataFromTreeTips idref="dataFromTreeTips10">
    </leafHeight>
    <leafHeight taxon="foo">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter6">
    </leafHeight>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <maskedParameter idref="maskedParameter3">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <mvPolyaLikelihood idref="mvPolyaLikelihood4">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <copyParameterValues idref="copyParameterValues10">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <matrixVectorProductParameter idref="matrixVectorProductParameter8">
    </leafTrait>
    <leafTrait taxon="foo" name="foo">
      <compoundParameter idref="compoundParameter2">
    </leafTrait>
    <outbreak>
      <categoryOutbreak idref="categoryOutbreak6">
    </outbreak>
  </partitionedTreeModel>
  ERROR!
</microsatelliteSimulator>

<microsatUpDownOperator> element

This element represents an operator that scales two parameters in different directions. Each operation involves selecting a scale uniformly at random between scaleFactor and 1/scaleFactor. The up parameter is multipled by this scale and the down parameter is divided by this scale.

The element takes following attributes:

  • scaleFactor is of type Double
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean

The element has the following contents:

  • Element named <up>

    Containing:

  • Element named <down>

    Containing:

Example:

<microsatUpDownOperator scaleFactor="1.0" weight="1.0" autoOptimize="true">
  <up/>
  <up/>
  <up/>
  <up/>
  <down/>
  <down/>
  <down/>
</microsatUpDownOperator>

<mixedDistributionLikelihood> element

Calculates the likelihood of some data given some mix of parametric distributions.

The element has the following contents:

Example:

<mixedDistributionLikelihood>
  <distribution0>
    <onePGammaDistributionModel idref="onePGammaDistributionModel6">
  </distribution0>
  <distribution1>
    <exponentialDistributionModel idref="exponentialDistributionModel1">
  </distribution1>
  <data>
    <jointParameter idref="jointParameter5">
  </data>
  <indicators>
    <bdcNClustersStatistic idref="bdcNClustersStatistic4">
  </indicators>
</mixedDistributionLikelihood>

<mixtureCartogramDiffusionModel> element

Describes a bivariate diffusion process using cartogram distances.

The element has the following contents:

  • Parameter element (exactly one)

  • Element named <mixture>

    Containing:

  • Element named <boundingBox>

    Containing:

Example:

<mixtureCartogramDiffusionModel>
  <designMatrix addIntercept="true" checkIdentifiability="true" form="foo" colDimension="1" rowDimension="1" standardize="true">
    <matrixVectorProductParameter idref="matrixVectorProductParameter1">
  </designMatrix>
  <mixture>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix3">
  </mixture>
  <boundingBox minX="1.0" maxX="1.0" minY="1.0" maxY="1.0"/>
</mixtureCartogramDiffusionModel>

<mixtureModel> element

This element represents a finite mixture of likelihood models.

The element takes following attributes:

  • normalize (optional) is of type Boolean

The element has the following contents:

Example:

<mixtureModel normalize="true">
  <multivariateNormalPrior>
    <meanParameter>
      <jointParameter idref="jointParameter7">
    </meanParameter>
    <precisionParameter>
      <compoundMatrixParameter idref="compoundMatrixParameter10">
    </precisionParameter>
    <transform idref="transform4">
    <transform idref="transform7">
  </multivariateNormalPrior>
  <gammaReferencePrior fileName="foo" parameterColumn="foo" burnin="1">
    <matrixMatrixProduct idref="matrixMatrixProduct1">
  </gammaReferencePrior>
  <treeDataLikelihood useAmbiguities="true" scalingScheme="foo">
    <partition>
      <microsatelliteSimulator idref="microsatelliteSimulator6">
      <siteModel idref="siteModel8">
    </partition>
    <treeModel idref="treeModel7">
  </treeDataLikelihood>
  <productParameter>
    <vectorSlice idref="vectorSlice5">
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView6">
    <mvPolyaLikelihood idref="mvPolyaLikelihood2">
  </productParameter>
</mixtureModel>

<mixtureModelBranchRates> element

This element returns a random discretized relaxed clock model.The branch rates are drawn from a continuous parametric distribution.

The element takes following attributes:

  • singleRootRate (optional) is of type Boolean
    “Whether only a single rate should be used for the two children branches of the root”
  • normalize (optional) is of type Boolean
    “Whether the mean rate has to be normalized to a particular value”
  • normalizeBranchRateTo (optional) is of type Double
    “The mean rate to normalize to, if normalizing”
  • useQuantilesForRates (optional) is of type Boolean
    “Whether or not to use quantiles to represent rates. If false then rates are not drawn specifically from any of the distributions”

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <distribution>
    The distribution model for rates among branches

    Containing:

  • Element named <distributionIndex>
    Operator that switches between the distributions of the branch rate distribution model

    Containing:

  • Element named <rateCategoryQuantiles>
    The quantiles for

    Containing:

Example:

<mixtureModelBranchRates singleRootRate="true" normalize="true" normalizeBranchRateTo="1.0" useQuantilesForRates="true">
  <empiricalTreeDistributionModel startingTree="1" iterate="true" fileName="foo">
    <partitionedTreeModel idref="partitionedTreeModel7">
  </empiricalTreeDistributionModel>
  <distribution>
    <inverseGammaDistributionModel idref="inverseGammaDistributionModel9">
  </distribution>
  <distribution>
    <onePGammaDistributionModel idref="onePGammaDistributionModel6">
  </distribution>
  <distribution>
    <inverseGammaDistributionModel idref="inverseGammaDistributionModel6">
  </distribution>
  <distributionIndex>
    <vectorSlice idref="vectorSlice9">
  </distributionIndex>
  <rateCategoryQuantiles>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter5">
  </rateCategoryQuantiles>
</mixtureModelBranchRates>

<mixtureModelLikelihood> element

This element represents a finite mixture of likelihood models.

The element takes following attributes:

  • normalize (optional) is of type Boolean

The element has the following contents:

Example:

<mixtureModelLikelihood normalize="true">
  <multiDimensionalScalingLikelihood fileName="foo" mdsDimension="1" useOld="true" includeTruncation="true" forceReorder="true">
    <locations>
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser8">
    </locations>
    <mdsPrecision>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter3">
    </mdsPrecision>
  </multiDimensionalScalingLikelihood>
  <alsTreeLikelihood useAmbiguities="true" storePartials="true" integrateGainRate="true" forceRescaling="true">
    <convert idref="convert4">
    <starTreeModel idref="starTreeModel7">
    ERROR!
    <observationProcess type="foo" taxon="foo"/>
  </alsTreeLikelihood>
  <argLocalClock/>
  <adaptableSizeFastMatrixParameter columns="1" rows="1" maxRowSize="1" maxColumnSize="1" startingValue="1.0" lowerTriangle="true"/>
</mixtureModelLikelihood>

<modeFindOperator> element

This element returns a mode finder that always accepts.

The element takes following attributes:

  • maxTimes (optional) is of type Integer
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • sd (optional) is of type Double

The element has the following contents:

Example:

<modeFindOperator maxTimes="1" weight="1.0" autoOptimize="true" sd="1.0">
  ERROR!
</modeFindOperator>

<modeIndependenceOperator> element

This element returns a multivariate normal random walk operator on a given parameter.

The element takes following attributes:

  • scaleFactor is of type Double
  • weight is of type Double
  • autoOptimize (optional) is of type Boolean
  • formXtXInverse (optional) is of type Boolean

The element has the following contents:

Example:

<modeIndependenceOperator scaleFactor="1.0" weight="1.0" autoOptimize="true" formXtXInverse="true">
  <matrixMatrixProduct>
    <left>
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView8">
    </left>
    <right>
      <buildCompoundSymmetricMatrix idref="buildCompoundSymmetricMatrix7">
    </right>
  </matrixMatrixProduct>
  <varMatrix>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix10">
  </varMatrix>
</modeIndependenceOperator>

<modelSpecificPseudoPrior> element

Calculates the likelihood of some data given some parametric or empirical distribution.

Example:

<modelSpecificPseudoPrior/>

<monophylyStatistic> element

A statistic that returns true if a given set of taxa are monophyletic for a given tree

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic for the purpose of logging”
  • inverse (optional) is of type Boolean
    “inverse, returns 0/false when monophyletic and 1/true when not monophyletic”

The element has the following contents:

  • Tree element (exactly one)

  • Element named <mrca>

    Containing:

    • One of:
      • Taxon elements (one or more)

      • Taxa element (exactly one)

  • Element named <ignore>
    An optional list of taxa to ignore from the test of monophyly

    Containing:

    • One of:
      • Taxon elements (one or more)

      • Taxa element (exactly one)

Example:

<monophylyStatistic name="foo" inverse="true">
  <newick usingDates="true" usingHeights="true" rescaleHeight="1.0" rescaleLength="1.0" units="days">
    foo
  </newick>
  <mrca>
    <taxa idref="taxa1">
  </mrca>
</monophylyStatistic>

<monotonicStatistic> element

The element takes following attributes:

  • order (optional) is of type String
  • strictlyMonotic (optional) is of type Boolean

The element has the following contents:

Example:

<monotonicStatistic order="foo" strictlyMonotic="true">
  <diffusionRateCovarianceStatistic name="foo" greatCircleDistance="true" diffusionCoefficient="true">
    <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel8">
    <inhibitionLikelihood idref="inhibitionLikelihood4">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood10">
    <multivariateTraitLikelihood idref="multivariateTraitLikelihood10">
    <inhibitionLikelihood idref="inhibitionLikelihood5">
  </diffusionRateCovarianceStatistic>
</monotonicStatistic>

<moveLegs> element

Operator which changes the way a tetraploid subtree joins the diploid tree.

The element takes following attributes:

The element has the following contents:

Example:

<moveLegs weight="1.0">
  <alloppspecies minGeneNodeHeight="1.0">
    <apsp idref="apsp10">
    <apsp idref="apsp10">
    <geneTrees>
      <starTreeModel idref="starTreeModel6">
      <partitionedTreeModel idref="partitionedTreeModel7">
      <gtree popfactor="1.0">
        <starTreeModel idref="starTreeModel2">
      </gtree>
    </geneTrees>
  </alloppspecies>
  <alloppSpeciesNetwork oneHybridization="true" diploidRootIsRoot="true">
    <alloppspecies idref="alloppspecies5">
    <tipPopulations value="1.0">
      <matrixVectorProductParameter idref="matrixVectorProductParameter7">
    </tipPopulations>
    <rootPopulations value="1.0">
      <hiddenClassRewardParameter idref="hiddenClassRewardParameter9">
    </rootPopulations>
    <hybridPopulations value="1.0">
      <compoundMatrixParameter idref="compoundMatrixParameter9">
    </hybridPopulations>
  </alloppSpeciesNetwork>
</moveLegs>

<mrcaTraitStatistic> element

A statistic that has as its value the height of the most recent common ancestor of a set of taxa in a given tree

The element takes following attributes:

  • name (optional) is of type String
    “A name for this statistic primarily for the purposes of logging”
  • trait is of type String
    “The name of the trait (can be rate)”
  • rate (optional) is of type Boolean

The element has the following contents:

  • TreeModel element (exactly one)

  • Element named <mrca>

    Containing:

    • Taxa element (exactly one)

Example:

<mrcaTraitStatistic name="foo" trait="foo" rate="true">
  <treeModel fixHeights="true" fixTree="true">
    <rescaledTree idref="rescaledTree4">
    <rootHeight>
      <designMatrix idref="designMatrix10">
    </rootHeight>
    <nodeHeights rootNode="true" internalNodes="true">
      <duplicatedParameter idref="duplicatedParameter2">
    </nodeHeights>
    <leafHeight taxon="foo">
      <fastBlockUpperTriangularMatrixParameterParser idref="fastBlockUpperTriangularMatrixParameterParser5">
    </leafHeight>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter2">
    </leafHeight>
    <leafHeight taxon="foo">
      <productParameter idref="productParameter4">
    </leafHeight>
    <leafHeight taxon="foo">
      <vectorSlice idref="vectorSlice2">
    </leafHeight>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <duplicatedParameter idref="duplicatedParameter8">
    </nodeTraits>
    <nodeTraits name="foo" rootNode="true" internalNodes="true" leafNodes="true" traitDimension="1" initialValue="1.0" fireTreeEvents="true" asMatrix="true">
      <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
    </nodeTraits>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <compoundFastMatrixParameter idref="compoundFastMatrixParameter2">
    </nodeRates>
    <nodeRates rootNode="true" internalNodes="true" leafNodes="true" initialValue="1.0">
      <differenceParameter idref="differenceParameter4">
    </nodeRates>
    <leafTrait taxon="foo" name="foo">
      <productParameter idref="productParameter5">
    </leafTrait>
  </treeModel>
  <mrca>
    <taxa idref="taxa4">
  </mrca>
</mrcaTraitStatistic>

<MsatFullAncestryImportanceSamplingOperator> element

This element represents an operator that samples the full ancestry given a microsatellite pattern and a tree

The element takes following attributes:

The element has the following contents:

Example:

<MsatFullAncestryImportanceSamplingOperator weight="1.0">
  <duplicatedParameter>
    <maskedParameter idref="maskedParameter5">
    <copies>
      <adaptableSizeFastMatrixParameter idref="adaptableSizeFastMatrixParameter9">
    </copies>
  </duplicatedParameter>
  <microsatelliteSamplerTreeModel provideInternalNodeValues="true">
    <tree>
      <treeModel idref="treeModel7">
    </tree>
    <internalValues>
      <immutableParameter idref="immutableParameter2">
    </internalValues>
    <externalValues>
      <microsatellitePattern idref="microsatellitePattern9">
    </externalValues>
  </microsatelliteSamplerTreeModel>
  ERROR!
  <rateEpochBranchRates continuousNormalization="true">
    <epoch transitionTime="1.0">
      <mvPolyaLikelihood idref="mvPolyaLikelihood8">
    </epoch>
    <rate>
      <matrixMatrixProduct idref="matrixMatrixProduct2">
    </rate>
  </rateEpochBranchRates>
</MsatFullAncestryImportanceSamplingOperator>

<msatModelSelectOperator> element

This element returns a microsatellite averaging operator on a given parameter.

The element takes following attributes:

The element has the following contents:

  • Element named <modelChoose>

    Containing:

  • Element named <modelIndicators>

    Containing:

Example:

<msatModelSelectOperator weight="1.0">
  <modelChoose>
    <compoundSymmetricMatrix idref="compoundSymmetricMatrix9">
  </modelChoose>
  <modelIndicators>
    <vectorSlice idref="vectorSlice4">
    <hiddenClassRewardParameter idref="hiddenClassRewardParameter9">
    <mvPolyaLikelihood idref="mvPolyaLikelihood3">
    <complementParameter idref="complementParameter4">
  </modelIndicators>
</msatModelSelectOperator>

<msatModelSwitchOperator> element

This element returns a microsatellite averaging operator on a given parameter.

The element takes following attributes:

The element has the following contents:

  • Element named <modelChoose>

    Containing:

  • Element named <dependencies>

    Containing:

  • Element named <variableIndices>

    Containing:

Example:

<msatModelSwitchOperator weight="1.0">
  <modelChoose>
    <vectorSlice idref="vectorSlice1">
  </modelChoose>
  <dependencies>
    <compoundParameter idref="compoundParameter10">
  </dependencies>
</msatModelSwitchOperator>

<msatPatternStatistic> element

Returns MsatPatternStatistic object

The element takes following attributes:

  • mode (optional) is of type String

The element has the following contents:

Example:

<msatPatternStatistic mode="foo">
  <microsatellitePattern id="foo" printDetails="true" printMsatPatContent="true">
    <taxa idref="taxa5">
    <microsatellite idref="microsatellite7">
    <microsatSeq>
        1,2,3,4,5,67,100
    </microsatSeq>
  </microsatellitePattern>
</msatPatternStatistic>

<MsatSingleAncestralStateGibbsOperator> element

This element represents an operator that samples the state of a single ancestor given a microsatellite pattern and a tree

The element takes following attributes:

The element has the following contents:

Example:

<MsatSingleAncestralStateGibbsOperator weight="1.0">
  <mvPolyaLikelihood>
    <data>
      <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter1">
    </data>
    <alpha>
      <differenceMatrixParameter idref="differenceMatrixParameter1">
    </alpha>
  </mvPolyaLikelihood>
  <microsatelliteSamplerTreeModel provideInternalNodeValues="true">
    <tree>
      <partitionedTreeModel idref="partitionedTreeModel1">
    </tree>
    <internalValues>
      <sumParameter idref="sumParameter7">
    </internalValues>
    <externalValues>
      <microsatellitePattern idref="microsatellitePattern5">
    </externalValues>
  </microsatelliteSamplerTreeModel>
  ERROR!
  <strictClockBranchRates>
    <rate>
      <approximateFactorAnalysisPrecision idref="approximateFactorAnalysisPrecision6">
    </rate>
  </strictClockBranchRates>
</MsatSingleAncestralStateGibbsOperator>

<mulMSCoalescent> element

Compute coalecent log-liklihood of a set of gene trees embedded inside one species tree.

The element has the following contents:

Example:

<mulMSCoalescent>
  <mulSpecies>
    <apsp idref="apsp1">
    <apsp idref="apsp4">
    <apsp idref="apsp5">
    <geneTrees>
      <partitionedTreeModel idref="partitionedTreeModel7">
      <gtree popfactor="1.0">
        <treeModel idref="treeModel2">
      </gtree>
      <gtree popfactor="1.0">
        <partitionedTreeModel idref="partitionedTreeModel2">
      </gtree>
      <gtree popfactor="1.0">
        <treeModel idref="treeModel8">
      </gtree>
      <gtree popfactor="1.0">
        <empiricalTreeDistributionModel idref="empiricalTreeDistributionModel3">
      </gtree>
    </geneTrees>
  </mulSpecies>
  <mulSpeciesTree constantRoot="true" constantPopulation="true">
    <mulSpecies idref="mulSpecies3">
    <sppSplitPopulations value="1.0">
      <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView2">
    </sppSplitPopulations>
  </mulSpeciesTree>
</mulMSCoalescent>

<mulSpecies> element

Binds taxa to gene trees with information about possibly allopolyploid species.

The element has the following contents:

Example:

<mulSpecies>
  <apsp ploidylevel="1.0">
    <individual idref="individual7">
  </apsp>
  <apsp ploidylevel="1.0">
    <individual idref="individual3">
    <individual idref="individual2">
    <individual idref="individual7">
  </apsp>
  <geneTrees>
    <gtree popfactor="1.0">
      <partitionedTreeModel idref="partitionedTreeModel10">
    </gtree>
    <gtree popfactor="1.0">
      <partitionedTreeModel idref="partitionedTreeModel2">
    </gtree>
    <gtree popfactor="1.0">
      <treeModel idref="treeModel4">
    </gtree>
  </geneTrees>
</mulSpecies>

<mulSpeciesTree> element

Multiply-labelled species tree which includes demographic function per branch.

The element takes following attributes:

  • constantRoot (optional) is of type Boolean
  • constantPopulation (optional) is of type Boolean

The element has the following contents:

Example:

<mulSpeciesTree constantRoot="true" constantPopulation="true">
  <mulSpecies>
    <apsp idref="apsp4">
    <apsp idref="apsp9">
    <geneTrees>
      <partitionedTreeModel idref="partitionedTreeModel10">
    </geneTrees>
  </mulSpecies>
  <sppSplitPopulations value="1.0">
    <copyParameterValues idref="copyParameterValues10">
  </sppSplitPopulations>
</mulSpeciesTree>

<mulSpeciesTreePrior> element

Prior for a multiply-labelled species tree for allopolyploids.

The element has the following contents:

Example:

<mulSpeciesTreePrior>
  <model>
    <randomLocalYuleModel idref="randomLocalYuleModel5">
  </model>
  <mulTree>
    <mulSpeciesTree idref="mulSpeciesTree4">
  </mulTree>
</mulSpeciesTreePrior>

<multiDimensionalScalingLikelihood> element

Provides the likelihood of pairwise distance given vectors of coordinatesfor points according to the multidimensional scaling scheme of XXX & Rafferty (xxxx).

The element takes following attributes:

  • fileName is of type String
    “The name of the file containing the assay table”
  • mdsDimension is of type Integer
    “The dimension of the space for MDS”
  • useOld (optional) is of type Boolean
  • includeTruncation (optional) is of type Boolean
  • forceReorder (optional) is of type Boolean

The element has the following contents:

Example:

<multiDimensionalScalingLikelihood fileName="foo" mdsDimension="1" useOld="true" includeTruncation="true" forceReorder="true">
  <locations>
    <diagonalContrainedMatrixView idref="diagonalContrainedMatrixView4">
  </locations>
  <mdsPrecision>
    <blockUpperTriangularMatrixParameter idref="blockUpperTriangularMatrixParameter4">
  </mdsPrecision>
</multiDimensionalScalingLikelihood>

<multiEpochExponential> element

A demographic model of multi-phae exponential growth.

The element takes following attributes:

  • units is of type String
    “the units”

The element has the following contents:

  • Element named <populationSize>

    Containing:

  • Element named <growthRate>

    Containing:

  • Element named <transitionTime>

    Containing:

Example:

<multiEpochExponential units="months">
  <populationSize>
    <jointParameter idref="jointParameter9">
  </populationSize>
  <growthRate>
    <diagonalMatrix idref="diagonalMatrix9">
  </growthRate>
  <transitionTime>
    <originDestinationDesignMatrix idref="originDestinationDesignMatrix9">
  </transitionTime>
</multiEpochExponential>

<multiLociDistance> element

Constructs a distance matrix from a pattern list or alignment

The element has the following contents:

Example:

<multiLociDistance>
  <distanceMatrix correction="SMM">
    <alignment idref="alignment5">
  </distanceMatrix>
  <distanceMatrix correction="SMM">
    <patternSubSet idref="patternSubSet1">
  </distanceMatrix>
  <distanceMatrix correction="JC">
    <alignment idref="alignment2">
  </distanceMatrix>
  <distanceMatrix correction="JC">
    <patternSubSet idref="patternSubSet8">
  </distanceMatrix>
</multiLociDistance>

<multivariateDiffusionModel> element

Describes a multivariate normal diffusion process.

The element has the following contents:

Example:

<multivariateDiffusionModel>
  <precisionMatrix>
    <diagonalMatrix idref="diagonalMatrix10">
  </precisionMatrix>
</multivariateDiffusionModel>

<multivariateDistributionLikelihood> element

Calculates the likelihood of some data under a given multivariate distribution.

The element takes following attributes:

  • dataAsMatrix (optional) is of type Boolean

The element has the following contents:

Example:

<multivariateDistributionLikelihood dataAsMatrix="true">
  <distribution>
    <treeTraitNormalDistribution idref="treeTraitNormalDistribution6">
  </distribution>
  <composedTransform>
    <outer>
      <composedTransform idref="composedTransform8">
    </outer>
    <inner>
      <inverseTransform idref="inverseTransform2">
    </inner>
  </composedTransform>
  <composedTransform>
    <outer>
      <inverseTransform idref="inverseTransform1">
    </outer>
    <inner>
      <composedTransform idref="composedTransform8">
    </inner>
  </composedTransform>
</multivariateDistributionLikelihood>

<multivariateGammaPrior> element

Calculates the likelihood of some data under a given multivariate-gamma distribution.

The element has the following contents:

  • One of:
    • Element named <shapeParameter>

      Containing:

    • Element named <meanParameter>

      Containing:

  • One of:
    • Element named <scaleParameter>

      Containing:

    • Element named <coefficientOfVariation>

      Containing:

  • Element named <data>

    Containing:

Example:

<multivariateGammaPrior>
  <shapeParameter>
    <productParameter idref="productParameter8">
  </shapeParameter>
  <scaleParameter>
    <elementWiseMatrixMultiplicationParameter idref="elementWiseMatrixMultiplicationParameter2">
  </scaleParameter>
  <data>
    <diagonalMatrix idref="diagonalMatrix9">
    <immutableParameter idref="immutableParameter1">
    <immutableParameter idref="immutableParameter10">
  </data>
</multivariateGammaPrior>

<multivariateInverseWishartPrior> element

Calculates the likelihood of some data under an Inverse-Wishart distribution.

The element takes following attributes:

The element has the following contents:

  • Element named <scaleMatrix>

    Containing: